Description :
From Genome Similarity Track
Location :
Scaffold_1011:1742- 3705
Sequence
1963 bases(100 bases per row)
CGAAGGTGTCCTTCATCGACACCGTGTACCGTGACGGTACACACCCGTGGTGTAGGTGTCTCCCATCGACACCATGTACCGTACGGTACTAACCTTTGGT
GCGGTACGCCCACCACAATGTTGCCATGTTTGGCGGCAACAGCTTCCGCTGTGCTGTCGCCTGAACAGATTCATGGCCAGTGCTCGCATCATGCACGACG
CATGTGCAAGCACAGTGTACAGGTCCATGAGCCCGTACACAAGGTACGCTGTGTACGACACGTACCACAGCTACCAAAAGTGCTCCGTGCACGTCATGTG
TGTCATGCACGACGAGTTCCCTACGTGGAACTCCTGGCAGGCTGCTCGACAGCAGCCAGTGCCGATGCACGGTACGCGCGTTGACTCACAGCGTCCAGAG
CGAATCGGGTCGTGGTATGGTGCATATCCTTTGCACCTATACCAGTGTCCGTCACAGACACCATGTACCTTGATGGTACTCGACCGTGGTGGGGCACATC
TCACCACTATGCCACTGCGGCATTGGTGTCTGGCATTGACACCGAGTACTCACGGGTACCAGCCCATGGTGAGGCAAGCAGCCATCACCACGATGTCATG
CTCGGCGCGGCACCAATTACGACTGCGTGCGTTGCCTCGACCACCACCTGGTCAGTTGTGTGTGCACTCGTGCACCACACTTGGGCTATGGCTCCACGGC
CCATTATACCCGGCGCGTTGCGTACATCACGTACCGCAACCGCTTTGTCGGCGGGTGAGACGTTCCGTTCACCCTACTCGACAGGTCGTTCATGGCCAAG
GGAACGGTGCGTTGATTGCACTAGGCCCGCGCTTCGCCTCGTGTGTGGTTGCTTGCAACCCCAACACTGCTGATTCGGTCAGCGATTCCGAGGCACCTTG
CGCCAGTGGCTTTCTTCGCCACTATGTCTTGTTCGGCTAGAGCTACCGCAGCTCTAGCCCGGCTGTTCGCCTCCAGCCTGCAGTCGATGTACATCGACGC
CTGGTTCCGTAAGGAACTTGGTCTTACCTCAAGACCAGGGAGGAAAGGTATTTCCGAGCCTCTCCCCCACTTACACTCGAGACTATTGAGTCTCTCGTGG
CTTGTGATAGTCACTGGCAGCACGACGGCTACTTGCCTCTTGGAAAGTCAGGGAGGAAAGGTGTTTCCGAGCCTCTCCCCCACTTAACCTCGAGACTACT
GAGTCTCGCGTGGTTTCTAATAGCCACTGGCAGGCGCAACGGCTCTCCGCCATGTGCACTGCGTCGGTATGGTCGACCGCGTCGGCCGTGTCGACCGAAG
GCATTCAGCCTTCGCGTCGGCAGTTTGAGTCTGCTCGACTTGACGTCGAGCGAGTTGCTCACGTCTGGCGAGGCCGAGACAACCTCGCGCCTCGAGCCAA
TGGCTCTGTGTGCGGCGCTATGGTACTCGCCTTGGGTGTGGACCTCTGTTACCCACACCGGAAGCGCATACAGCGACTTCCTTATCAGTTATAGTCTGAG
TGACCTTGCGTGGAACTTTGTTACCCACGCTCGGAGCACCGAATGTCGGTCTCCTTAAGCAGCTTCGCTGCTTGCGGAACTTGTTACCCGCAGTGTGGAC
CTATGTTACCCACCTGGTGAATGCTCTTCGGCACCACCACTGTCGAAGCGCATACGGCGCGACGACCTTCGGTGTTGGGATCGGCTGGTGTGGCAGACCC
GCACACACACCGGACAGTGTTGGTGTCCACCGACCGAGTCAGAGGAGTCTGGGCCCTGGACTCCGCGTCGCTTGAAGCGACGGCGGCCTGAACAAGGTTC
AGACCCGACTTGCGGCGGCTGACGTGACGTGGCACTTTGTTACCCACGTCGTGATGTCTCGTTGACGACATCAAAGGCACTCGAGACCTCGTGTGGCACT
GTGTTACCCACACAGGAAGCATGGACAATGCCTTCCTCTTCAGTTATAGTCTGGGCGACTGCG