Description :
From Genome Similarity Track
Location :
Scaffold_4:174191- 176663
Transcript NameFunction/comments
Physo_500943RNA-binding protein, putative
Physo_501970P-type ATPase (P-ATPase) Superfamily

Sequence
2472 bases(100 bases per row)
CGCGTTGGAGGCCGAGGCATCCGGCGGTCGAGGAGGTCGCGGTGGCCGGTGGTCTGCTGGTCGCGGCTACAGAGGAGGCCGTGGCGGCCGTGGACGCGGA
GGCTTCGGCCGCGGCTCGCACACGCTGGACAACCGCACCACGATCGTGAAGGTGGCGAACCTGCCGGAGGAGGCGCGCGACCCGATTGTGCTGACTCAGC
ACTTTGGCAACTTTGGCTCCGTCGAGCGCGTCGTGATGGACGAGGCCGCGCCCGGCCAGGGCTTCATCAAGTTCCAGGACCGCTACGCCGGCCAGGCAGC
GCTGAACCACGGCACCATGTTCGGCGACAAGCAGTTGGAGATGGGGTGGGTGGAGTCCCAGGAGGCGCCCGCGGAGCTAACACGGAGTGACTCACCGACA
ACAGCAGCAGCGTCTGCTGGCGCGGAAGCTGGCGACGGCAATGTGGCGGCGGCATCAAGCGACCAGGTACGATTTGCTCTTTGGCGTGATCAGGACACGG
CGACCCACACCGCACACACACGACTAACTTGTATCTGTTGCTGTTGCTGCCTGGATACTTTCACGCGAGCAGGTCTCCGCGAGTGCGTAGCCGGCCCTGC
GATCCGACGCCATCGTCCTGAGTCATGACTCATGACAGGGAAGGAAGCTCCAGCAGCTGAGCAGCCCACGCCGGACACTGCTAGCAGGTCAAGTAGTCGG
TCCGAGCTATAAAGCGATGATATAGGAAGCCTGCAATTGGCTAAAATACGCAATTCAAGTGGAATGGTTGTATGTTCTTTCCTAGAGAGGTCTTGCAGTG
CATGTTGTGTCCGACAGACACCACCTGTGGCGCAGAGGTGTCTGCGAGCTGCTCTCTGCTCGGAGCGTCCCAGAAAATGTCAGTGTGTTGAGACGGAGGG
GGCGGCGGAACCAATGTTTTCCAGGCGGCAAGATGGCTCGGGCCTGCTGTCTGCCACGACTGTGGGGCATATTACCCAGCAGGCTTGGGACACACCAGAG
GTCCTAATAATCACCCGCGATCCGGTGCTTCAACGCAACATATCAAACTTGCCGCGGTCAGTCGTCTGCTTGCAAGAGAGTGCTGTGCCGCGATGTAAGA
GCTGGGAGCTGCCCACGCAGTCAGTCGCAGGTAACGCTTGGCTCGTTTTTCCAGGTTGCAGTGGTCAAGGTGATTACGCCTCCAGCAGAACCTACAAATT
CAGGAGCCAGTCGATTACGCGGTCCTGCAAAATCCTGGCCAACCCTGGCCAATCCGATCCTTCTTATTGCATCCACAAGACGCGCTGCGTCACGAAACGG
GGCAGCTCGCCTCATTGAGCAGCGCTGGACGATCGCCAAACTTACTTATAGGCAGGTGCAAGACGCTTGCATTTCCGTTAGAAGACCGTTTCTTTTGATC
TTCCGTGGTTGGCCTTTGCTCTTGCAGTCAAGTTCGAAGGCGATAGCAGTAACTTATTCTGAAAAATGACTGCGCTGAACTCCAGTTTACACTAGTTAAT
GCAGTCAAGTCTCAACCGCAGGAATGATTCATACGGGAAAGCTGCAGCACGTCTACCCGGAGTTTGTCCAACGTAAGATGTGATAGTACAGTGACGCTAG
TTGCCGCCAGCGACCCGTGCCGCACGCCGGAATGGTTCGCACGAGGTCTGACCACTGTAGCATGCGAAAATTAACGCGAAAGAAAGCGTCAGCGCTGCAA
ACGCGGGCAAAAAATTCCAAGTTGCTCTCCATTGAGCTTCTCGACGGCCCCAACACCGAGCGGCCAGGTATAAACGGTATAAAAGCACGATGCGGTCATT
TCGCCTCGAGCGCTGAGGTAGCGGCGTTCCTCAACGCGCGATGAGACAACCCATAGATGCACCGGTTTTGTGTCGTTTACTTTCCAATCTACAGGCAAAC
CTAGAGCGACCTACAAAACCTCCGTCTCGAAAAGACCGCCCGTGCTCATCAACTCTTCCCATACATCGCAACTGTTGAGCGTCACGCCATCGCTGCCATC
TTTCCGACACGCATCGACGATTACTACGCCGCTAAAAATACCGACCTCCTGGAATCGCGGCGTCAGTCGCTATAATTCCCGGCCCGGGACACCTCGCTCT
TTGCCTGTTAATGGACCGCCGCGAGAGCGACGCCGGCGCCACGGGCGGCACGCCCCGCACCGCGCAGGCGCAGTACCACCGCCTGCAGTCGTCGCCCCAG
GCCGGCGCGCACCGCAGCGAGTCCGCCGCCTACCCGCCGGCCACCGCGCCCTCGGCGTCGCCACTGCGCGCCACCGTCGCGGACGCCACCAGCGCGAGCG
CCGCGGCCTTCAACCCGTCCAGATACTTCCACCGCAACCAGACGGTCGAGGTGCTGCCGCGCCAGCCCGCGGGGCCCTCGGACCTGCCCAAGTCGCGCCC
CAACTCGGAGCTCTTCCGCACGCTCACGTCGTCGCAGCTGCTTAACTTCCGCCAGCGCCTGCTGGACGACGA