Description :
From Genome Similarity Track
Location :
Scaffold_64:174132- 176589
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_10806peptidase, partial

Sequence
2457 bases(100 bases per row)
ACACCGCGGCCTTGGTGTCGTCCTTGCCGCAGATGGCCTCGGTCGGGCGCGGCGGCACACCATACGCGAGGCCGTCGATGCGGAAGGCGTCGACACCGTC
AAGGAGCGCAATGTCTTCGCGCGGCGGCGTGTACGAGAGCACGATCGAGCCGCCGGGAATGTACTCGGCGTAAAAGTTGTCGCGGTCCCCACCCGTGTAC
TTGACCGACGTCGCGCCATCGGGCGACGAGAGCGTGAGGACGGCACCATTCGGCAAGTTGAGCGAGTCAAAGTGCAGCGAGAGATACGACGCGGCGTCGC
GCGAAATGACGGTGCGCAGCGGCACCGACCCGTTGGACGAGAGTTCGTACGGAGCCGTGCGACCGATCTCGTCGGCGCCCTGGAAGCACGTCTGGCCCGC
GACGAGCGACGCCGCGAGGCCAACGAGCGCAGTGAGCTTGGCAAACGAAATCATAGTGATGCAGATGTGGCAAAAGGAAAAGTGAGGTACGAGTCGCTGG
CCAAAGCGTCAGTACTAGTGGCCACACACTCACTCGTGGATCTGATGGCATCCATGGGCGGTTGAGCCAACACGAAGGCATCTGAGAACCGAACGCTGCG
ATGCTTGGAGAATGCACCTGAGAATCGTGCGGATTCGTACCCTTTGGCGCACAGCTAATCGCCGATGGCATCGGAGCCAACGCTCTCGCGCGACGTCTGC
CGCACTCGATGAGCGACTGGGTCGGAACGAAATCCATCGTTCGAACTCGATACACAAGCTACTTTTACTTCAACACTCTACTGAAAGATGAATAGCGTGT
ATCACTGGGCTGGTCTCGAGCAGCTTAGCAGCGTTCGTTTGCCGTACGCGTAGGCGCAGTTGACAATGTTGACCGCATCCGGTACGGTGCTGATTTGGCG
TACCTTGTCTGAGTCGGATACCTCAGTTATGAGATGTGCTCAGACAAACGTACTCAGATTGAAGCAGCCAAGGTGGGACTCTCAGGTCATTGGAAGGGTC
ACGCACCCACGAAATCATTGATCCGAGAAACATCATCTGATGGGATCTGGGAGTCCAGAACAATGTGATTTGGAACCGTGCAGAGCCAAAGACGACTACC
GGTACTATGTGCACCTGGTCTTGGCAGACTCATGTGGCAGCAATTCACGTTTGGCTTGCACGTTGCATCGACCAACCATACTACCCGTTAACTTTGCACA
TTCAAACGATCATTTGCACGCAAGACCATAAAAACACGCAACGGCAAGGCGTTGAACCGTGCTACCGCGTGAACTCAGACACATGTCTGGTTTCACTTGT
ATCTGAGTAGTTTGCTCTGATAATCGTGGCCTGCGTGCATATGATGACACCGGCAGGTTCGACGCGCAACCAGCCTTGGGTTGTACAGGGCCTGGTACAT
GTACATGTACTTAGCTCAGAGGAACAGCCCAGTGACAACGGCCCACTTTGCATTTGCGAGTGATGGGTTGAACACAGATCCGTTGGTGGTCTGATTCACG
CGGACTAAACACGACCCACATGTTCTCCTCGCTTCTGACCATACCGGTACATGTATCAGCTATATGTATCGTCTTGTGCTTCATGGCCCTCGCCCGCCCC
ACATTGCTCTTCCTAGCGCTCGCGCCACCAGCTAGTTCCTACGTAAAAGTAGCTTGTGTATCGAGTTCGAACGATGGATTTCGTTCCGACCCAGTCGCTC
ATCGAGTGCGGCAGACGTCGCGCGAGAGCGTTGGCTCCGATGCCATCGGCGATTAGCTGTGCGCCAAAGGGTACGAATCCGCACGATTCTCAGGTGCATT
CTCCAAGCATCGCAGCGTTCGGTTCTCAGATGCCTTCGTGTTGGCTCAACCGCCCATGGATGCCATCAGATCCACGAGTGAGTGTGTGGCCACTAGTACT
GACGCTTTGGCCAGCGACTCGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN