Description :
From Genome Similarity Track
Location :
Scaffold_4:174111- 181696
Transcript NameFunction/comments
Phyke_g444hypothetical protein PHYSODRAFT_343916
Phyke_g445conserved hypothetical protein
Phyke_g446splicing factor, arginine/serine-rich, putative
Phyke_g447hypothetical protein PHYSODRAFT_349219
Phyke_g448hypothetical protein PHYSODRAFT_473667

Sequence
7585 bases(100 bases per row)
GTAAATTGGCGGAAGCATCGAAAAGCAGTTAATGATCCATCCAACAAGGCGGTACCTCGCAACTTGGCCGCGCCTTTTAAGAGGGTTGCTGAGCGTATCC
TGCGTTGCCATGAGATAAACGTGAAGCACGTGGCTTGCAAGAAGGTTGACATCGTTTTCGTGGTCGGTTGCCAGGTCTGCTGCGAGGCTCTGACCACCGC
ATAAAAAGCTGCTTAGAGCGATTACGGCCGCTTCAATGCGCAGGAGTTCGAGCGATGACTCTCGGTTGTGCAAGACACTGGACTTCAGCCAGAGATTCAG
AAGCTTTTCCAAGTTGGCCTTTACCCATTGTTCGTCGTTCATGGCCACTAGACTGCCCACCAACGTCCAACCAGCGCGTGTGCAGGTGAGCCAAACACTA
TCAGCACATTCACTGAGGAATTGGCTTTCGACAAGCTCCTCTGAAATCGTATAGATGTCGTCCATTACCGCTTGCGATAATCCGCCCTTGTTTTCGAGCT
TGATGGCCCGAAGTACATGAGCGATCGCAGTAGATCGACCCTGAATTGCATACAGATGAATCTTGCTTTGTCCATCATTGGtttcatcttggccatcgtC
TGCTGTTTCAGCCGAACCCGAATTTCTTGCCTCTTCAGCGTCTGACCCACCATGCATTAGAAATTCGGCAGTATCCCGAAGACCCACAAGGCATTCAGTA
AGTGCACTTTTAAGTCGATACGGGATCGCAGTGACGAGGGAAGCCAAAGCGACAGCCGCCTGAAAGCGCACACTTTGCTTAGCGTGACAGAGAAGCCCTT
GGAATACACAACCAGCGTTGTGCGCGTGACTTACAGCAGCCTCGCCCATCGAGTGGAACATATGACTCAGCTCCACTAGGACGGATAGTGTCTTGTGGTG
ATTCGGTTCTGGAGCTTTTGACTCGTCTTTGAGTTTTTGCAGGTACGCCCCTAGCAGAGCCTCTTGCTGTCGCTCTGTAAGACATACGTTGATTCCATAG
CGCAGCACAAAGCCAACAGCATTGCGCGCACGCGTTAAATCTCCCAGCGCGAACGGGTGGTCAAGGATAGCGAGGGTGGCATCCACGACCTCGTGAAGTT
GCGACTCAGCAATCGAATCTGGCGGCAGTCGTTCAAACATGCTGCACAGGGCGATTGAAAATGATGAGAGAATACCTCCATGACTCTGGTTTGGGTTGCT
TGAAAGGTACTTGGAGGTCACCATGTCCTTGAAGTAGAGGACTACGTTTGGAATGGTGGAGAAGTTAACCATGGCGGCTTTCCGTCGAGAAAGAGGCAAG
CTGATTGTCGACATCCCAGGAACATGTAGCTTGAACGCTAGCTTAGACTTCCCAGGAGCACCATCTTGCTCCATCGAATGCCGTCCACCGGTATCCTCAT
CAGTGCTGGCACTATTGCTTTCACCGCCTCCCACCTGAATTTCGGTTTCGCCTGAAGACGATGTCGCGTACTTAGCAAGCACCGTACCGACTACCACTGA
GtacgttcttcttgcttcgGGTGAATCATCATCCATACCCTTGGCTGTGATTTGTAGGATTGCATCCAGCGACACACCTAGAGTTCCACCATGattgctg
cctccaccgcTTGAAGTGACTGCCGACACACCTCCGCTGCCAAGAGCACCACTTCCACTGCCATTTCCATTGCTACCTTGGCTTCCTGCTCCACTTGACC
CACTGCCAGCAGCCGCGTTCGTCGACACCGACGTGCATTCCgccaccacttgcagcagctttgcagcagcgatcCGCACTTCAGGAACCTTGTCCTGGCA
CGTCTTCACTACAATCTTGAGTGCTTCAGCATGGAAAGGTACCAATCGAAGTGAGTTTCCTTCTAATGCATGAGCTACACTCTCCAATAGACACTGCTTC
AAGTAATAGTCTGCAGCGCGAATGTTCTTGCTGATAAGAGTGACCACATCTGGCAGGAACTGCATGGCATCCTGCAACGACAGACGAcacaccaccatca
ccagcgACACCTTTATATACAGCGACATGTTCTTGGACAGCAAATTCTCGTTGATTGTAGGCACCACGGAATAGTCAAAAGAGCGCACGAGCAAGTCGCA
CACCAGGCGGTGGATACATTCGGACGTGTTAACACTTGAGGACGACAAAGAGACACCCATGGCGCCTGCACCCGCTCCGGCTGCGCCAGAACCAGAGCTG
TTTGTGTTCCCACCGCTGTAGACGATTAAAGTggccagaagcagctggaaaAGCGCCGCATTGCTCTTCGAGCTCCGCTTCTTGGCGGGTGTCGGGTTTG
TCAGCAGCTCTGGCTTCCACAGTCGTTGTAGAGCGAACAACGCCTGGATCAACTCgcgctgctgtgtctgttgCTCCGCGGCAGTCCCTCCTCCAGCGCG
TATGGCCTCTACAGCGGCCGCCAGCTGCCGCGCCGCGCCCTTCATCgcctcctctctctctctgtaTGAGGGACACTTGGCAAGAAGTGGATTAAGGGTA
TCTCAAAATGGGTAAATCCTTAGGTTTTACCCATTTATTCTAGACACATTTCTTGCGAAGAAGTCGAAAATgatgcagacgacgacgcggTCGTGGGAGG
AGCTGCGAGGTAGTGCGCGCACAGTGGAGCGCACGCTGGAGGACAAGATCGCAGCGTATACGGCTATCAGTAGAGCGCAGTCGCGTAACTCAACCGCCGT
TTACGACGAAGGTAGACAGATAACTGGCAGCTCGAagacgaaagcgacgatACTGACGgcttctttttttcttcttgtgtctgttcatctcttcttctgc
gtATTTATTGTAGAAAATCCGCCAGAGGAAACAGCAGATGAGAGGGAGCTGGCAGTGGATATCGAGAACGCACTAACGTCGGTGGGTGATcacgagctgt
tgctgctattgctgctattgctgctgttacaAGTGTAGATGATGACACTGTTTTGCTTGTTGTGACTGTTCAGTTGTCCGATACAATCGATGAGATGAAT
GTACACGTCAATAGGACGTCGGTAAAAACGCAGGACGCCATGTTGCAGCGCTACCGTGAGGTCTATTTCGACTTCAACACGGAGTTCCGTCGTTCGATGG
TAGGGGCGGGCTCTAAACTTACGTCTAGCTAACAGATGGCCGCGTCGTGACTTACCCATGCATGTCTGCATACTTATCCACTGAGCAGAGCTCATTGCAG
GAGAAGCGTGAAGCCCAGAAACTCTTCGGCAACAGGTATGTGCTGTTCTAGCTGTGGATGTGAGCATACCTTATAATTGCTGTTTTGTAATGATGTGTTT
CGTCTGGTAGAACCCACAACGGACACTCAGAGGATGTCGAGATGGACTCGCTACTGAACGAGCGTCGAGCGGTGGACTCGTCGCGATCCATGACCAGCAG
CATTATCGAGTGTGTCTTGCACTGTTGTTTAATATCTTTATTATTATTGATTCTTAACAATGACTAACATGTGTATGCTTTGTTTTATTTCAGGCAAGCG
ATGGCTACCAAGAACGCGCTGGAGAATCAGCGTCGGCAGTTCACGTCCTCGCACGGCAAAGTGGCCACTCTGGGCAGCTCGTTCGCCGGTATTAACACGC
TCGTGGATCAGATCCGTCGCAAGAAGATGCGGAACAACACTATTCTCGCGCTGGTGATCGCAGGCTGCGTCTGCTTCACGCTGTGGTGGGTCGTGTTGTC
TAAGATCTAAGTAAATGGCTATTCCTGCCGCACAACGGCATTTATCATCAAGGTCCGAGTCATTACATTGCTCAAGCTGTATCATCTTGAAGAGGGTAAT
ACACATCTATTatgattcgctgaaaataAATAAAAGTCGCTTAAAATACAAATAACAAGAtttcattggttgaaaagagATGGCTGGTTGGCGTGGAAAT
TGCGTTGCCATACTGCAAAATTTGAGCCAAAGGCCAAGCAAACCGACACCTACGGCAACTCGACGAGACAATGTCCGACCGTGGAGACCGTGGAGACCGC
GGAGGGAtttcgctgctggtgcgcaACATTAGCCGTCGTCTGAGGTACGTAGGTGTCTACACCGCACTCTTTATGCCTTTTACTCGTCGGTTTAGCCCAT
TGCAACGCCAGATAACTGACTGAATGCGATCTATTGGACACTGCAGACCGGAGGACATAAGAAAGGAATTTGAACGCTACGGTGAAGTGCGCGACGTGTA
CATCCCCAAGGATTATTACACCAAGTGCGTATGCTAACATGCAGCAATCAAGTCATTGCGTGGAGGCATAAAAGAAGAGAACTGGTGCTGACGAAACACT
TTGTTGATGTGCAATGAACCAGGGAACCCAAGGGCTTTGCATTCGTCGAGTTCAAAAGTGACCGTGAGGCGGAAGACGCACGTCGCAATTTGGATGGCGT
TCGGATTGATGGCCGCGATATCCGTGTGGTGTTTGCGCAGGAGCGTCGCAAGTCGACTGACCAGATGCGCGAGCGTGAAAAGTGCGTCCGTCTTCCATAC
ACTGTGTTGTTACCATGAAACGTAGTGCTTACCGATTACTGTGTGTGATGTATGCAGGACGGAGAAGCcacgtggtggtggccgcCGGGGTTCTCGATCG
CGCTCCCGCTCGCCGCctcgtggtcgtggtcgtggtcgtggccGCTCCCGCTCCCGTGACCGCCGTGCTCCAGCCCGTCGTTCGTCGCGCTCGCGCTCTC
CAGTGAAGGGACGATCGCGTTCGCGGTCTCGCTCGGGGTCACGTGGCCGCTCCCCTGCTCGGCGCTCCGCGTCACCGGCCCAGAAACCTCGTTCGGTGTC
GCCTCGCCGCTCTGCATCTCCTCGCGCCACGGGTTCGCCACGTCGCTCGGCATCGCCGGCTGCACGCTCGGGGTCCGCGTCGCCTCGCCGTTCTAGAGGT
CGGTCGTTCTCGGCGTCACCCCGACGAGAAGACCGCCGCTCGCCCTCAGGCTCCCCTCCACGATCGAACGATCGCGTCAAGGAGGAACGGGACTAGTTCA
TTCGGGTTCTACAAGTCATTAGCGACAATCTCTGAAGCTTCACCAACCGATCGACTGAGCGCCCGGCATGGACAACTGCACGTCATCCCGCTTTGATTTC
CTTCCCTCTGCCACCCTTTCGTGTGAgattgtttgctgctggtgttgcatATTCCTCTACCAGATTCAGGTGCAAGAAACAGTCACAAGaacagaagatg
aagatggaaGCTCAAAGAAACACAAACGCAAATAAAAACAAAGAAGACTGGGTACTCCACTGCAACTACACTTgaccaagaggaagagaaggagaagacg
atCCCCAGCCGATCAGATCTGCGTTAGCACCGGGTGTCGTCGTGAGGTGTCGAGTCTTATCATTCGCCTCTTTTAATGGCGTTGATGTTTCGCTCCGTTG
ATGGCAAGAGATTTGGAGACCAGGCCGCACACTCGGACGATTCTGTCCACCATATGCATCGCATACTTTCTGAAGAGGACAACTTTAGATCTCTCAGTTG
AGGATGTGGACGCTTACGACCACTAAAATTGCTAAAAGTGTCGATAAATGAACGCGTACTTAATCGGGACGACACAGTAGACCTATTGAAACGCATTCGC
ACTGTATCAGGCAAGAAGGTCCTtatcatgaagaagcgatCGGTGGTGTTCGTTCTTATCGACGGCCTAGCCGATGTCTCACTGCAAGAGTTGGACCAGC
AGTCGCCTCTAGAGGCAGCGCAGACCCCTGCTATGGATGCCATCGCCAGTACGTCATTATTCTCAACACTATCAACACTATagaaaaaaaaaatactTAC
AAAATTCTGCTTGGGGTCTGCTCTCTCTCTTATGCTTTGTAGACGGTGGGTTGACTGGTCTCATGGATCCTGTGGAGCCTGGCTACGCGTGTGGAAGCGA
CACGGCGCATATGTCCATTATGGGCTACAACCCCATCATGTACGAGCCTTCTGCAGCCAATATCATTCTTTCTGTTACTGACTGCTGTGGTTATATGTTT
GGTGCAATGCAGTCACTACCGTGGCCGCGGGTCGTTTGAAGCCATGGGAGCAGGACTGCCAATGGCCAAGGGCGACGTCGCCTTCAAGTGCAATTTCGCT
ACTGTCCAGGAGAATGAGGACGGCCAGCGGATTGTGGAGAGACGTCGAGTGGATCGCAACTTTCCAGCTTGGGGCATTGATCTCTGTTCATTCCTAGATG
GACTTACGCTGCCAGAGTTCCCAGGCTTCGTTGTGGCTACAAAGTATGCCACGGAGCACCGCTGTGGTATTGTGTTTAAGGGACCTGGACTTTGTGACAA
GATCACGGGCACCGATCCGTTGAAAGATCAGTACGTAGTTGTCCCTTTTCAACTCGCATATTTGTTACGCATATCTTAACGAGATGTTTCTTGCTGCGTA
GTCTGCCGCTCGTGGCATCTGAACCGCTGAATGACTCGCCAGAAGCGGAGTACTCCAGCAAGGTGCTGAATGCCGTGTCTGAGGCTATCCATGAGCGCCT
GTCGGATCACCCGATCAACAAGGCACGCGAAGGAGAGGGCAAGCCACCTGCGAACGTAGTATTATTGCGTGGGCCAGGTGAACGCATTGACGTGCCTACC
TTCGCGGAAATGCATGGGCTCAATCCCTTTATGATCGCGCCCACGTGCATCATCGCAGGTCTGGGTATGTCGCTGGGTTTTGAAATTGCTACCGCCCCTG
GTGCCACTGGCGACTACCATACGAACTTGCTTTCAAAGGCTGAGACAGcattgaagttgctgagTGGTGACGACTTCGATTTTGGCTTTGTGCACGTTAA
GGCTGTAGACGACGCTGGTCACGACCGTgacgtggccaagaaggtgcaCTTTATCGAGCGCGCTGACGAAATGATCTCTCGTCTGGTGGAAGGTATTCAC
GCTGAGTATGGGGAGGAGAGCAACGAGGTGACCATTGTAGTCACGGGCGACCACACAACACCAGTTAAGTATGGAGACCATACGTTTGAGCCTGTGCCTT
TCGCCATCGCGCGCGTCGGGGCTGCATATGAGCGCTTGCAGCATTCCAAAAGCGCAGGTGAACCCGCCAGCGACAATGCTGCATCATCTAGTCCATTGAC
AGACGACGTGACGCGGTTCTCTGAGTTGAGCGTGGGACGTGGAGCTCTTGGTCGTTTTGCTGGAGACCAGGTTATGAAGCTCGTCAAGGCTTTCCGCGAA
TACGAAGTATAACTTCTCGACGGCCATGGTTCAGACTAGGCGCGGTCTTCTTTGTAAAGTCCGGTTAAAATCCCATTATCAATGATAAAATGCCAAGTCA
TGGAAGACTCGTACTAAGACTCACTTCGTGGAATTCTCTTAATCGACACGAAACATGCGCGCCGTTGTGCGGGAGATAATAGCCATGATCTCCTCAATCT
CGACGTCGGTGAGGTGCTTTGCCAGACTGGGAATAAGtgccacagcctcctcaACTTCCTCCGGATTCAAGTTTGACAGACATGCGATCTCGAACTCCTC
CAGCCGGTGCTCTACTGGTTGCCCGTTTTCTTCATGCTGAAATGCGATTGCCATTAAAGCCCTACAGGTGCAATGTGTACACACA