Description :
From Genome Similarity Track
Location :
Scaffold_127:17410- 22398
Transcript NameFunction/comments
Physo_143014reverse transcriptase

Sequence
4988 bases(100 bases per row)
AGTAGGTCAAGCTGGCCAATGTATTAATCCAGTCTTAACCGTATCGCTAGTTCAGTACCCAAAGTGTCGACGCTGCCGAGGCCAATGTAGTTCCTGGAAC
TTGGTGATTTGATGGGACTTGTGGTCTTCGGTGCAAATTCTGCTCTGATTTATGTTTAGCTGGTCTCTCCCTAATGCTACCATCTTGCTTACCCTCCTAC
AGCCACACGATTACTGGATTCTTGTCCCGACTTCGTCCTCCATGTGCGTCCCATCCTGGTCTATCCACGATCGGCCCCGATCGGCGATCGACCTCGATCT
GCGATCGGCGATCAACTCCCAATCGATGACTTATGCCGGTTGACATGCGCCGCCGATCCATCACCTTCTGTCCTCGGCCATCCCAGATCCGCGAGTTCTG
TCGTCGATCTGGACTTGGGTCGGCTCCGAATCACGCCGCGGTTCGGGCACGATCACCCACAATCCGGCTTGCCACATGTCCTGCCTCACGCGCCGGCGTC
ATCGGACCACCTGAGATCTCCCGAAGAACTCCTTCTGATCCGTAGATCCTTGCTGCCTGTCTCTCGATCGCCGAACTCCCACGCCTCCAGTCGATCGGCC
CTGCCGCCTTTCTCGGAGAACAATTCTTATTCAGCACTTCTCCACACGAACGTCTTCTCGCGTCCGAGGTGGCCGCCGCTCGGCGTGTCATGGAACTCGT
GGATCAGCCGAGCTCGGAGATCGTCGTCCAGAGGAACGACGATGCGCGGGGGATCTTCACGGTCGACGCGGTACGTGAGCAACTCGACGTCCAGCGAGTA
GCGGTCGACGCCGGAGCGGCTGCGTGAGACAGCTGCGCTTCGCCCCGGCACCAGGGTCTCGCAGGAACTGGATCAGCTCCAAGCAGGACGCGTCCTCCTG
NTACGCGTCCACGATCAAGTCACGGAGCGGACTGGTCGCTGCAACCTCAACAGCAGCGACGTCTTCGGCAGTGCATACGGCGCATTCGTCGTCGTCCTCG
TCACCAACTGTGTGGCGACCTGACTGCACGTAGTCAGGCCGACGCGATAACGCGTCGGCAAGGATGTTGGTCTTGCCCGGCTTGTAGTGCACGACGAAGT
TGTACTCGGAGAACAGGGACAACCAGCGCGCCATGCGCTGGGACAAGTGAGGGCTCTTCGTCGCTGTCCTCAACGACGCGTGATCGGTGTAGATCGCGAA
AGTCTGTTCGCCGAGGAGATACACGCGGAACTTGATGAGGGCGTAGCGCATGGCCAGCAGCTCCTTATCATGGACCGGATAATTCCGTTCCGCCGGCTTC
AGCTGACGCGACCGGTAGCTGATGACCCGCTCGCGTCCTTCGTCATCGAACAGCATCAAGGCGCATCCGATCGCGAAGTCGCTCGCGTCGCACACGACAT
GGAAGGGCTTCGAGTGGTCTGGAAGCATGAGCACAGGCGCGGTGGCCAAGTTCGACTTCACCGCGTCGAAGGCAGCTTGGTGCTCGAGACGCCACGACCA
CGTGGCGTCTGCCTTGAGGAGTTGAGATAGCGGGCGGATCGTCGAAGCGAAGTTCGTCGAGTAATGGTGAAGATACGTGGCGAGCCCCAGCCACTGCCGG
AGCTGCTTCTGGTCCTGCGGCGTCGGCCACGCGCAGATTGCCTCGATCTTCTCGGGGTCGGCGCGGACACCGTCCTTGCTGACGTAGCTCCCGAGCACAG
GGATCTCGGGAGCGCAGAAGATGCACTTCTTCAAGTTGGCGTACAGCTTGTTCTCCTTCATCACCTCGAACACCTTGCGCAGGTGTTGTAGGTGGATCTC
AACGTCCGTCATGCCGTCCTCGGCACGACTGTGAATGAAGATGTCGTCGAAGTAGCTGGGCGCGAAGTCTCGGTACGGCCGAAGCAAGTTGGACACCATC
CGATTGAAGGTGGCGGGGGCGTTCTTGAGCCCCTGCGGCATCACGAGCCATTTCCACAACATCCCGCTGGGCGTGCTGACCGCTGTTAGCAGCACATCGT
CTTCGCGCATCAAGATCTGATAGAAGCTATCCATCAGATCAATGGCACTGTACTTCGTGCTGCCAGACATGGTGTCCAGCACCATGTCCTTCCTCGGGAT
CAGCGTTTGCGCCGGTATGGTGGCCTCGTTGAGCTTGTTGAAGGCGTGGACGATTCTCCAGCCGCCGGTTGGTTTCTTCACGCAGAACGTCGGACTGGAG
TGCGGCGAGAGACTCTCGCGAATGTGGCCGGCTTGCCGGCGACTCTCGAAGAAGGCGTCAATGGCTTCGACTTGGTCGCGAGGAAGCGGCCACTGCCGCG
TCACACAGTACTTCGCACCGGGCACGAGGTCAATCTCGTGCCGAACACCGCGGTCGGGTGGAAGAACGGCTGGAACCTTGTCCGGGAAAATCTCCATGAA
CTCGCGCACGAGCGGAGCGACTGGGTTGCCGGCCGCTTCGAACGCCGGCAACGACTGAGCTGCGTAGCGGGCTTGACGGGCGTTCTTAAGCTCGCCTCCT
TTTGGGCGCGTCCTGGCGTCGGAAGCTGGGTCCGACGCACTGGTTGCGACGGCCGCAATTGACTCGGCGTCTTCAGCGACGATCATGCACACCTGCTCGA
TCTCGCCCTTCTTCAGGTCACGGAGGAAGTGTTTCCACGAGAGCCCAGGCAGCCGAGTGATCTCGGCGGCGTCGCACGGTGGACGTGCGACTTCGACGTC
GCGTACACGCGGAGGCGCCTCCGCGTCGTCCCCCACCAGGAATGAGATCACTTCAGCCTCAGCCTCAACTGAGTCCGCCGAAGGCGTACGAGGATGGCGC
AGGTTGCGACGTTCGCGACGTCGAATCGGACGTGGAGTGTTGTCCGAAGCTGCCGATGAGAGCCCATGCTCGATCACGGCCGCTGAACTGGGGCGCCGGG
ACACAACGTCGGCGCCTGGACGCGGGTCATTGGACACGACCGCGTCGACTTCATCAGGGAGCTCCCGCTCGACCACTCGCGGGAACCCATGCTCGACCGC
GTGTGGGAGGCCACGCTCAACCACATCTTCTCGTACTTCAGCTTTGAAGAGCCGCTGCTCGTCCTGACGTGGTTCGACCACGTCATTGTCTGCTTCCGAG
AACCGCTGCTCATCGGGACGTGGGAACCCATGCTCGACCACGTCAGACACGTCCTGAGGCTCCTGCTCAGGACCGGCGCAGGTTGCGAGTTCGCACACCG
CACACGAAGGGCCATCACTCGCTTCGTGCGCAGCATGGGTCATTGAGTCGGGGTCCATGACGGCAACATGCGGCCACTGGTTAGGCGTTCCGCACAGAAA
CGCAAATACTGCATTGACATCAATGTCTCGGAGGCGGACTGTGCCAGTCAGCCAGTTGATCTCAGGCTGGTGGCGAGCGAGCCACGGGATGCCGAAGACA
CAGTCGAACGAGCCGCTCAGCTCGATCACCAAGAACTCCTCGGAACTGCGGAACCCGTCGAACTCGTACGCGAAGGTCACCGAGCGCCGCGGCGTCCGCC
GTGGCTTCCCACCAGCGTACTTCACGATCATGTCGCCAGGCCCGTCGCGAATGTTCAAGTCCGCCGGTAACACCGACAAGCTCTCGGCGCGAACGAAGTT
GTTCGTTGCGCCCGAGTCCAGCAGCGCGCGAAGAGGGCGCGTCGCGCCGTCAACATGGAGACTAAGCACAATCAGCCTCGTGTCACTGCCGGAGGTGGTG
GCAAAGAGTTGTGCATGAAGCACGGGAGGGCTAGGAGGAGGTTCTGCCACCAGAGAACCATCTCTCCTTCCACAACCAGTAGAGCGCCCCGCACCTACTG
GTTGTCGCCGTTTTTTTGGAGCGGTGACGTCGTTCGCGACCGTGACGTTCGCCTGCATCGGCGCCGGAGCGCGGCAAATAGCCGCGCGATGTCCAGGTTT
CCCACAGCGGCAGCAGCGCATCGGGCGGGGACTGCACGTTGACGAGGCCGTTGGCGGCCTTGCTGATGATGTCGGCACCCGACGTCCACCGAACTGTTGA
ATCGCATCCACCTCCATCGGCTCCGGCTCGGGCACCGGGGCCCGAGAGACATCGAAAGCCTGCGACGCCGTCACACCGTAGTCTTCACGGAGCCCAACAG
CGAAGGCCTCTTCGAGTGTCGGTGGGGTCTTCCGGGTCAGGTAGAAGCGCTGGTAGCCAGCGCTCATGCCGGAGATGAAGACGTGGACTTGGGTCGCCAT
GTCTACGGGATGCGTTGTGATGCACGACACAAGGTGTCCTGCGCGCTGGATGTACTCGAACATGGACATGCGGCCTTGCTTCAATGCCAGGAAGGCGGAG
CGCTGAACGCTTTCATCTTGGGGCGGCTCGAACGCGAGTCGCAAGTCCGCCTTCGTCGATGCCATGGTCGGGAAGCAGGAAGCGTCGGCCACGAGCTTGC
CGAGCGCCCACTCCTTCGCCTTACCCGCCAGCTTGGACAGGAGAAAGCGCGTGCGCGCGAGCTCGGTAGACAGCTGCCGAGCTTCGATCGCGATGTCCAC
CTCGCAGAACCAGCGGTTCAGGTGAAGGCGGCCCTCGCCTTCACCGCTGTACGTGGAGACATCGAGCTTCACGATATCGGACTTGTTCTTGGTCTGCGTG
GGAGTCGACACTCGCTGACGGAGGTCAGCGAGTTCACGCGCCATGAACTCCTGGGCGGCCAGACGTTGTTGTTCCTCGGTTCCTGCCGTCAGCAGTGTCT
TGATCACAGCGTCACCAGACACCGCTGCGAGGAGGTGTAGCGCCTCCCACTCGGTCGCCGACAGGTGCGGAAAGCTGGCGTGCTCGAGTGAAGTGGCAGT
CGTCCGGGACGCGTCAGGCATCGACGTGTCGTTATGATCATCACGATCTTGGGCGTTGGACGGATTAGCGAAGCGCTACCAGGTGTAACGGGCTAACTGC
AGCCCGTTACGTGCTTACACAAGTAGAGGAAGTAGTAGGCAAATTGAACTCTGATTGATTAATTGACACGGCGTAACCGCCGTGTCCA