Description :
From Genome Similarity Track
Location :
scaffold_478:17405- 18844
Sequence
1439 bases(100 bases per row)
TAAGAGAAGTAGCCCGCTCAGATGAATCAAAAGTCTCAGACACAGAAAATTCCGTCGCGGAGTGTTTTTTTACGGACTGTTTTCGCACTCGTCCCATTTC
CACGTCAAATAGAGATTTGGCACGTGGAGTAACGTTGTGATCTGCAGCAACCCACGATGAACAAATGTCCACCCTCTGTCTTAGCCCTTCGGATACAGTT
CGCAAAATTTCTCCAGAGCACCTTGCGGAAAACAATCGTGAAGGCCAGAACACTTGAAGACGTTGTTTAGTCCTTCAGCAGCACTCGTTGACCGAACATC
AAAGAGAGGCATCGGGTCGCCGTATGAAGGTGTGTTGGGCTATTCCTCTTGAATCCTATCAAGTTCACTTTGAGTCAAAGGATAGTTTCCCAATTTTGTC
CAGCTCGTCGGATGCAATTTTTTTCAAGTAGTCTCGCATATATTCTTCGTTTTCAGTGCCAGCTTTGATTGGTTCTGGGAAAGTTTTGTGGATCTCATCT
AAAACCAATTCGTACTGGAGTCGAGAAGACACATTCTGCAGTTTAAATACAAGAGCTTGAGCAACTGACTTATCATTTTCCGACAGTCGAAATCTGGATG
CGACATTGAATGCAATACGAAGACTGCAGATATCGCGAAGTCGGTGAAACTTTTACCGCGGTGCAGGTGGCGTACGGTGACCCAGAAGTACGACTACTGA
AACGATATCAGAGTCGTACGGCGTGGGTGGGCGTGTGTTACCTTGCGGTATCCTCGTGGGTCCGTTGTCTTGGGAATATGACCCTCGCCGGAGTCTAAAG
TTGAGTGAAGAGAGTAGGGGTATCCTTGAAGTCTGGTGTCGGAATTGCTCAGGTCCTTCCAGGAGCGTTCGGGAGTCGGGCGTTCTGATAACCACGTAAG
TTACCAGAGTGCTAGTAGTCAAAGAGAGATCAATACACAACAGGAAGCCTGATATCGGTCTCTGAATATCACAAATTCAGAACCGAGATACCAGACTTCA
GAGATAACAACCAAAATATACAGAGTTCAGGGATATACAAATATAAACAACCGCTTCTTATTCTTTCCTGGCCCTTGAGCGGTGGGCTAGTACTCCAGGT
CAACTAGGGATTCGTTACCAGACACCTGGTCTGTCTGGTATCCCTGTCCTTGTCGCGCACCACCCTCTAATATAGAGGGAAATAAAACAATACAATCGGT
TATATACAACTGTCTAGTGTGCAGTCTGGAAACGACTGTCTAGTTTCCAGAGTCTGTCCAAACGAGCAATATGAAATGGGCTACCGCTAGAGACAAAACA
AACGACCCAACTAGGATATGGAATGGGCGGGTCCTTTCAGGTCTCTGCGTTACGCTAATCTCCGCCTAAGGGGACTGGTAAGGCGAGAGATCACACAGCA
CTAGTCCTTGCTGTGGCCTTACACTTCCGAAGAACCGAC