Description :
From Genome Similarity Track
Location :
Scaffold_2:174048- 177588
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G001119Similar to NLRC3: Protein NLRC3 (Homo sapiens)
Pytul_DAOMBR144PYU1_G001118Protein of unknown function

Sequence
3540 bases(100 bases per row)
GGCGACGGCCAAGAGCCTCTACGTGCTCAGCACGCGCAAGATCACGGAGGCCGACGCCAAGCGTCTTGCGGAGAGCATCGCAGTCAACGCACAGCTCGAA
GAGCTCTACCTCTCGGGCCACCGACTCGGACAAGAAGGGCTCCAGGCGTTTGCGGACTGCATTGCGGTAAACACGACGCTCAAGCATCTCTGCGTGGGCG
AAGACTCGCTCGGTGATGAGGGCGTCAAGGTGCTCTGTGACGGTATTGCGCGCAACACGAACTCGGGGCTCCAGATCTGGGACCTGGAGCACAAGTCGAT
TGCCTTGGCCGGTGCTGCGGCACTTGGCAAGTTGCTGGAAACCAACACGACGCTCCACACGCTGACGATCTCGCGCAATGCGTTAGGAGACGAAGCTATT
GGTGAGCTTCTTGCGGGTTCCCGCGCGAATCCACAGCCAGCGCTGAAGCATTTGTTGGCGACGGATATTGGTGTCACTGGCGCTGCGCTCGAGCACTTTG
CATCGCTGCTAAAGGTGTCCACGTGCTCGCTCGAGTCCCTGCAGCTCTCGTTTAATGGGTTGGAGTCTGCGACCACGACTTTCTTTGACGCGCTAGCGAG
CAACACGTCGCTCAAGAAGCTCCACTTGAAAGACTGCAAGCTCAACGACACGCACGCGGAAGCGCTCGGAAACGCGTTGAAGCAGAATGCGACGCTCGAA
GAGATCGATCTCTCGGACAACAGCTTGACACCCGCTGCATGCGCTGCGCTCGCCGAAGGACTCAAGAAGAACGCGACGCTCAAGTCGCTCAACCTTGGAA
ACAACAAGTGCCAAGACGCTGGCGCCATCCTCATTGGCCAAGCGCTCGCAGCGAATGCGTCGACCTCCAAGCTTGCCTACCTCGACCTGAGCAAGAACGA
ACTCACACACACCGGCATCATCGCTCTGATCGAATCGTCCCCGGTGAAGGAGCTGCATGTGTTTAACAACACGATCGGCACGGGTCTCCATGAGCTGCTT
CCCGTTCTCACGGCAAACCACTGCATCGAGCACTTGGACGTCGGCGCGAACCAATTGCATGGCGCGCTGAGCATTGCGCTCTTTGACGCGATCCACAGCC
ACCCAACGCTGAAGACGCTGGAAATGGGCGGCAATAGCTTGGGCGAAGATGGCCACGAGGCGCTGGACAGACTCCGCCAAGCGAACCGTGGCCTCGACGT
CGCTGTCGACAAGAATGCGCAGGATGAGAATGGTAATTTCAACTTTGAAAAGTAAATAGACGCCCCCTTCCATATTTGTAACTAAACTACCGCAGCGATT
TCGAATTGCACGGAGCTACCTCATCGTAGTTGTGCTGTAAGTTCGCGTCCTTTTTCTCCTTCAGGAAATTTACCACTTCGAAAATAATTAATGCGTTGCA
AGTGATGTCATCATTCTTCGTGTTGCTCGGTCGCGTTTCGCAATAGAGGCGCGAGCGCTGCCTCAACGACGTCCACTGAGAGCGACTTCTTAAATTGCGT
CAGATCGTCTCTCATCTCCACCTGCCACTTCTCGACTTCGTGCTGGATAGTCTCCAGCAGCGAAAGCGTATGAACTTCGTCTTCTTCGGCGAGCAGTCGG
ACGTACTCACTCCACACGACATAGTTCTCCTCTAACTTTCTCACCGCGGTGTATGACTCGGAAATGCTCGATTCGAACTTGCTAATGCGAGTTAGCAATG
CCTGGTGATACTCGTGAGAGTCTCGCATTGTGATCGCAGCTCGAAGCAATCCTGATGCACCAAAGATGAAACCCAGCAGCAGACAGAAGTATCCCACGAG
CGAGAGAGTCCATGAGCATTTTGTCTCTGGTGCTGAACGTACAGATCCACTGGGCGTTCGCATCACACGGTCCCCAGCATCACCGCTATTACTCTCGGCA
CTCTCGGCCACAGCTTCACCTCCGGAATTGTCATCTAACTCGTGCACCGGAGAGAGTCGCTGCGTCGCACGATCAACTGGCTTCACATTCCACTGCAAGG
GCTGTTCCATCGAATACAGAGACGCACTTGTACGGCCACTTTGAGCGTCACTCTTGACTGGGTCCGGACTGGGTTTTGCCATGGCATTTCTTTGTCGCTC
TGATTTCTTCTCGTTTTCTTCAGCTGACGCTGGCCTTGACTTACTGACTAAGCCTTCACGCACAATCTCATTAAAGTGCCGCTCCACTTCAGCCCGCTCA
GCATCGGCGATGGACTGTTTCACAGCCCGCGGTCGGCGAGATGGGTACTCTTGTTGCAGCATCTTTTCCCTAGCAAGAGAAGGGTTTTTGTGGGTAGTCT
TGCCCACCCTTCGCTGTTCACTGGGTCGTGCCATCCTTCGGCTTTCGTGATCTTCGACAAAATCTCTCTTCAAATCTTCATCAGTCTTTCGATTGACACT
GAAATCGTGAACCTGGTATGAGAATTCAAAATCTTCAGCAGCAGCAGCAACATTCTGTGACTCTGTCTGTGCGCTGGGAAAAAGAGCATCTGCTGCGTTG
CTGTAATCCTTTTCCTTGACTTCAGCGGTAGAAAAGATCTGATCAGAAAGAAGAGGTCTTGAAGACGGTTCAATCATCTTGTTTGCAGGTTGCCTCAAAG
GAATACCGCGCGCGTCCACCTTCGCCAACGTAAGCAGAGCAGCCATTTTCTCTTGAATGCCTTTCAAATTCTCCAACGCATCTTTGGGTAGAGTTTTTGG
GTTTGGCTTATTAAGATCAATGTCAACTCGTCCCTGAGCGGCTGGCCTTTGCTTCACCCCTTCGTCTCTCTCAGATTGTTTGAAATCAATATCGACTTGC
TCACGAATGCCCGGTGCTCCTTCCAGGTATACTTGATCCAGAAAACTGTCGTCATTACTCTGAGCTTGTCCGCGAACTTCTTTGATTTCTTCTGCATGAT
CTCGTCCCTGAGTGACTGGCACTTGCTCCACGATGTCGTTTCTCAGAAATTCTTCAAAGTCAGTTGCCGCATGCCCACGAACATCAGCTGTGTCTTGCAA
ATATACCGGATCCAAGAAATCGCGGTCATTTATGCTGGCTTGTTCATGAACGTCCTTGACTTCTTGCAGGTAGACCTGATCCAAGAAATTGCGGTTATTT
ATGCTGACTTGTTCACGAACTTCAACGACTTCTTTCGCGCAATCTTGTTGCATTAGATTTGGATTGATCAGCATCGTCTCTTCGATATCTACGTCGTTGG
AAGCCACAACTGTCGCTTCAAACACACTCGTAGTCTCGCTTAGCACTCCACTTGCAGCCTTGTCGTCTGGATTGGCCTCGATGCTGCTTGCAGCTACTTG
TAACGTCACTTGCTCCATGTTGGTTTCCACGACTTGTTGCGGTTTTTCTTGAATAAATAATTCCGAGTCATCTAAGGAGATTGTCGGAGGCACAGGATCG
TCTTGTGGCAGTTGAGTGCTGCTTTCGTTTATTGGGACGGGGATGGCATCACTTTCGACAACGTGGATTCTTGGACGTCGTGCTCGGACAGTTATGTTCG
CATCGGATCGGGGAGTTGGAGACGTAGCTGAGCTAGGAAT