Description :
From Genome Similarity Track
Location :
scaffold_13:1740097- 1746735
Transcript NameFunction/comments
Plaha_PHALS_06452callose synthase

Sequence
6638 bases(100 bases per row)
CGTCGGCGCGCAAGCTCTAACTACTTTGAGCTGGATGCTGATCGACGCCGCAACAAGTCGGAGCGCTCGGAACGATTTAGTAAGCGCCTCAGTACGATGG
AAATGACGCCTTCGAGTACTAAAGGCACGGCACAGGACGATGAGATTGCTGTAGATTATTGTTGCGAGTTTCTCAGGGCAAAATTTGGGTTTCAAGAAGG
TTCTGTGAGTAATCAGCGAGAACATGTATTGCTTTTATTGGCTAATGGCAAGGCACGGTGTCAGTCGACCGACGCGGCCGACCACCATCTCTTGCAATTG
GCCAATAAATTGTTTATGAACTATCATTCGTGGTGCAAGTTTCTGCATGCGACGCCAGTCACTTATACAGGCAATAAcgtgccaaattcaacttctGCTG
GCAATTTGTATATGGATGTGATGCTCTACTTTTTGATTTGGGGAGAAGCTGCCAATGCTCGTCTTTTGCCTGAATGTCTGTGTTATCTATTCCACCAGAT
GCTGACGATGGTGAATgccgacccacaaggcaacGAACAACAGCCGGAGGGGTGGTACTTAGACCAAGTGATTCGTCCAATCTGGAGAGAAGCGAGCAAC
ATGAAGCGGCGCAACGCGCTAGGAATGCCTCTAGAGCATGTAAAAATTCGAAATTACGATGATATCAACGAATACTTTTGGAAAGCTCACTGTTTGAGCA
TTCCGGTGACACAAGTAGGTCAGGAACTGACTCAAAATCATGGCAAGACATTTTATGAACACCGCAGTATTTTTACGATGGTACTGAATTATTACAGaat
ttttcaatttcaaatgaTGTTGCTTGTCCTTTTAACAGTATTAGCCTTTGCTGTAACGATTTCACCTGATGGTGGTCAAGGTGGCTGGGCGCAATTTGGT
AGCATTGGCGACGTAGTGGCACCTTACAGCACTCGTGACTTGAGAGTGGCGATTGTGGCCGTTCCGTTCAGTTTAAGTTTGATGGCTTTTTTTAAATGTG
TCATGGAAGTGTGCCACGGATGGCATTTGCTCGTTTCAAAAGAAAGTTCCACAACAAGCTCCCGATCTCTCACGTATGGTATGGCATTGGGCACTCGCAT
TATCTGGAATGGTGGTTTTGCTATTCTATTTGCAATCATGATTTATGTACCACTGAATGAAGACCGAGACACGATGTTGCTTGATAATCTTTATACACTG
TGTGGTGCATACATTCTGCCTGGAGTGTTGATCCTGCTAACCCAAGCGTTTGCGCCGCAACTGATTAATAGTACGTTTGCCGTCAAGTTTGTACGTGAGG
GGGAAAGCTGTTATGTTGGTCAAGACATGATGCCTCCTTTATCGTACAAGATCAAGTACATAACGTTCTGGATTGGCCTATGGATTATCGAATCCATTAC
TGCCTACGTGATCCTCGTGCGTCCATTGATTCTTCCAACCCTAAGCATTTATGATATGCATCTCGACTATCAAAATTCACTGGTATCGTTTCACAATATC
GGTATCATTGTGGCATTATGGCTTCCTGTCGTGTGCATTTTTAACTATTCCACTCAAATTTTCTTCACTATTTTTCAGGCATTATTGGGTGGATTTCAGG
GTATTCTTATGAAAACGGGTGAGATTCATGGCGGAAAAGAAATGACTAAAGCCTTTCGTGTGGCCCCACAGTTGTTTGACCAGAAAGTTGTGACTCTGCT
CGCAAGATCCAGTGATGCACCTACGAGTAGTATGGATAATGTCCGTGCCAGTGCCGTGGCGGCTGCATACGAGTCGCAAATGATGCTTCGATTTGTGGTA
GTTTGGAATGAGATAGTTAATTCGTTTCGGGTAGGGGATTTACTAGATGATAAAGAAGCAGCGGTACTTCAGTACGATATTCGAAGCACCGGAGAAGTTT
TTGAACCAGTGTTTTTATCGGCTGGGAAACTCACTGAAGCCGTGGGATTGGTTATCAAAGCAGCCAAAGAAGGCAAAGGTGAGTCTCAGCTGCGCGTGAC
GCTGGTGGAGAATGACTGTTTATCGGCCAATCGATCATTCTTTACTGCCAGTATGTACGTCATTAGTGCACTTTTCGGCACAGACGACgcggacgtcgtg
gacggGTTTCGTATGATGGAGGAGCTGGCGGCCAATGGTGGATTCCTTAAGTCGTTTAATGTCCGTGAGTTGGCCACTTTGCGTCTTGCAACAGTAGATT
TACTGGAGGAAATCCTTGACTTACCGGATCCAGATGTGCAGTCACAACACATTCCAAACACTCAAGTTCATTCGATGGGGGTCATACGCAATTTTGTGGC
CAAAATGGAAACATTTCTAAACCATGTTCAGTCGTTTTGCGTCGATCCAGCCTTGCAGCGTAAGTTCAGCAACTCAAAATTCTGCACAAGTGCCAATGGC
TACATGTATGCTTCGCGCGGACTGGTCAACTTGTTTTGCAGTGACACGGCTATGGGTGCTGCCACACGTGCGTGTTTGCTCTTGTCGCTGGATCGATCGG
AAGCAATGCCTCGGACTATGGAAGCGCAACGTCGTCTTGGTTTTTTTATGAAATCGCTGGTGATGGACATCCCGCAGCTGCGTTCGATCAAGGAAATGCG
CAGTTTTTCGGTTGTGACACCATTTTATGCTGAAACAGTCTTGTTTTCCCTGAAAGACTTGAATGATCCCCTTGTGAACCATCCAATTTTTCAGCAAGTA
GAAGAAGATGGGAAGAATTTGACGATTTTAAAATACCTGACCAAGATTCACCAAGAAGAATGGGACAATTTCTTAGAACGTGTTGATGTGAGTTCAGCTG
AAGAAGCGCAGAAGAAGTACCCAGAAGAAATTCGATTGTGGGCTTCGTATCGTGGTCAAACTTTGGCGCGTACAGTGCAAGGAATGATGATGTACGAGGA
TGCGATCAAGATTCTTCACTGGCTTGAAATCGGGTCGAGTCCTGGCAAGACCCCAGAGCAGAAGCAGAGCCAATTGCAAGATATGGTGCGGCTGAAGTTC
TCGTATGTTTGCGCGTGCCAAGTGTATGGTAAACATCGTCTCGAAGGAAAGGCGCAAGCCGCAGATATCGACTATTTGCTGCGAGAGTACCCGAATCTGC
GTGTAGCGTACGTGGACACTGTGGAGTGCAATGGAGATAAAATTTTCGATACTGTGTTGATCAAAAGCGAAGCTGACGAGATTGTTGAAGTTTATCGCTA
CTCGCTACCAGGTGACCCAGTACTTGGAGAAGGAAAACCAGAGAATCAGAACAATGCCCTTCCCTTTACTCGAGGCGAGTTTGTCCAGACTATCGACATG
AATCAACAGCATTACTTTGAAGAGTGTCTGAAGATGCCCCAACTTCTATGTACTGCTGATTTGCATCCATCAAAGAAACCGGTCTCAATCATTGGTATGC
GTGAGCACATTTTCACTGGAAATGCCAGCTCGTTGGCAAAGTTCAAGACGTGGCAAGAGCTGGTTTTCGTAACGCTATCACAGCGTGTGCTGGCCGATCC
ATTGTGTGTACGAATGCATTATGGTCATCCTGACGTGTTTGACAAAGTTTTGGCCATCACTCGTGGTGGTGTCTCGAAAGCTTCTAAGGGCATCAACTTG
TCGGAAGATGTCTTTGCTGGATTTAACACGACGTTGCGTGGTGGAGTCGTGACACATGTGGAATTTATGCAGTGTGGTAAAGGACGAGATGTGGCATTAT
CACAGATCTCCATGTTTGAAGGCAAATTGGGCAATGGCGCAGGTGAAACGTCGTTGTCACGTGAAGCTCATCGAATGGGTCAGTTTATGGACTTCTTTCG
CCTAAACTCCATGTTCTATGCCCATACGGGATTTTTCTATGCTACCTGGATGACAATTGTCACAACGTTTGTGTATATGTACTGCAAAGTGTATATTGCC
TTATCGGGTGTTCAGTCACAAATTGTGTACAATTTGAATTCGACCGAAGTGATTATGGGTAATTCCGAGACCTATGGCTTTGATAATCGGGTGTTTGAAG
ACATGGACTCGGTGTATAATACGCAGTACTATATCCAAGCAGGGCTTTTTCTATCGCTGCCGTTGATCTGCGTATACTTTGCTGAAATGGGTGTATTACG
TGGTCTGGTACAGTTTCTAGAAATGGTGTTCACTTTAGGTCCAGTTTTTTTCATCTTTCAACTTGGCACGACCATGCACTTTTTCGATAACAATTTGCTG
CATGGTGAAGCAAGTTATAAAGCTACTGGTCGTGGGTTTAAAATTACAAGAGAGACATTTGTGTTGCTTTATAAAGCCTACGCGTCAAGTCATTACCGCA
AAGCCATGGAACTCATCGGCTTGTGTCTCGTGTACTTAGCCTTTGGTGCGTTCGAAATTTGTGATACGTCTGTGGCTGGTGAAGAGAATTCGCTGGCGTT
TGAATATTGTGATACGTCACAAAGTTTTGGCGTACAAACGTTTGCCATTTGGGTCATTGCTGTCGTGTGGCTCGTGGCTCCATACATTTTCAATACGGAT
GGACTGGATTGGGAAAAGACGAAAGCAGATGTTGCAACATGGGCCAAGTGGATGTACGCTACTGAAGATTACGTTGACAAAGACCAGGTGATGGTTGGAG
GATGGATTGGGTGGTGGAAAGGCGAGCTGAAAGCATATCACAACTCGAAACCTATTGCTCGCCTAACGGTGTTATTTAGGGAATGTCGCCACTTTGTGCT
CATGTGGTATGTTGTAGCACTCGAATGGGAAATTTTGACCGTTGGACTTGTCTTTGCATTTGCAGTGGTTACGATCTTGGCCATGGGACTCTTTGGGACG
GTAAATGGCACAATGCGCAACATCAAAGCAACTGTTCGTGCTATCATGTACACATGTACAGTGACGATGGCAGTGATCATATATTTCGTCATAGCAATGG
CAATTTTCGATTTAAGCTTTACTCGTGCCATATCTCTTTTTTTTGGGTATATGGCTGCGCTGTATGGACTGAATGAAATGGCGCGTATGTACAGTTTTGC
CTCGTCGTCTATTGCCACCGTAGGCATGTTCCAGCAACTGGCTTTCTTTTTCGACTTTGTATTTTCTGTGTCCATGATTATCCCGCTTTTGATTATGTCG
GCGGTTCCGTTTTTAAACATTGTGCAAACGAGAATGATGTACAATAAAGGCTTTTCTGAAGTCGTTTCAGCTTCGTCCCAGTATGCATTCTCACTAGCTG
CATTTATGGGGATGTTGGGCGGCATTGGCTGTGGCTGGATGTTTCACTTGTTCACATCACTTGAAAGTACTGCTGGCTTCTTGAGTTATGCTACAACGTA
CAGCTTGCTTGATGGCAACGTTGGTGATGGTACAGTCACATACGCTTTCTACTTCGCCAACATCTTTGGTACCTTTTTGGCAGGAGTTCTTAATCACTTT
ATCGGCCGACGTTTGACGATTGTGCTTGGTGGTCTGTTGACTGTTTCTGGAATGCTTGGAGTCAGTGCAGTGCAATCAGCTGGCGAAGCCTTGTTGTTGC
CAGGCATCTGCTTACTCGGGAGCTCTGTTGGTGTGCTGATGCCAACCTTGGCTGTCTATATTTACGAGATTTCAACTCGTGACATGCGTGGAAAAGCATT
GCTGCTTTTAGGCTGTGGTTTTATCCTTGGCATTCTATTTGCCGcttggttctcctcatcttcgGACGAAGTCGGATGGGTGTGGCAAGTGTTCATTGCG
ACTATTATTTTGTCCATTATGACACCAGCTGTGTACATTTTCCCGGAAAGTCCGTATTGGGTGTATATGCGCAAAGGTCTTGAGTCGTGTGAACGCTGTC
TGACTATATTACGGCGAAAGGAGAGTGTTTATGAAGAGCTAAGAATGATTCGTGATGAAGAAGCGGGCAGTGATGACTCGAGTGCAAGTGGAGGCACGTT
GTTCTTAAAGTTCTTGGTGGGTCTCATGTTGATGCTTGTGTCTAGTATTTTTCTGGGCTGTGTCAACATGTATATGTCAAATACGTTTCGCAGCATGGAA
GACGCGACGTACACATTTGTCAACTGTATGGCCATGCAACTCCTTGGTGCtctcttttcttttttctttatGGATCGAATTGATCACAAGCGCATTCTCT
TTTGCACGTTGCTGCCAATGGCAGTGCTTGCAGTAGTATTGGGACTGAATGACCATTCCCCGTTTTTCTCGGGTCATAATGAATTTGTCTTGTTGCAGAT
TCTGGGATTATTAATTTACTTCTTTGCGGGACTTGGTATCACGTCAGTGCCTTGGGTTTCGTGTGTGGGACTTTTTAAGACGAGTCAACGTGCCGTATCG
GTAACTGGCTATTTCATGGTGTTTTTTCTTCTGCCTGTGTGTGCGACTTATATTCGATCGAACGAAGCCGGAAATGGCGGTCCATATTTGTACCTATTTG
CATTAAGTGGATGCTGTGTAGCTGCTATTGGGATTTTGTTCACGACAGGGACGCTCAAAAATGGAATGGTGTGTACCAAGGGTGAGATGGAGGCTGAACG
CACACGGCTCCGTCGAATTCGTGCATCTCGTCGGAGTGCTCGCACACCCGGCAGCGCACGTTCAAGAAATCTTAGTCGCTCGCGCGTAAAGTCGCACTCG
AATTATCAAATGTATGATTCGCCTTCTGGCAGTGCGCC