Description :
From Genome Similarity Track
Location :
Scaffold_229:1740- 3070
Transcript NameFunction/comments
g12822.t1hypothetical protein

Sequence
1330 bases(100 bases per row)
TTTCAACACTCCTCCACGCCGGCAGCGGCGACCTCCCTCTCGTCTCAATGGAGACCTACGATGTCCCACAGGTTATCCAGTCTCGGTGCCTCCAAGGCCT
TGGTGAGGACGTCTGCTGGCATCTTCTCGCTCTCTAGGTACTCGGCCTTGAGCACCCCGCGCTTCGCAAGCGCGCCCACGAACTTGATGCGCACATCAAT
GTGCTTCGCCTTGCTCGATGAGCCTTCACCGTCGAGCTGCTTGAGCGCCGCTTGATTGTCGACACGCAGCGACATCGGGCTGGCATGCGTGATGCCCAGC
TCGCCAAGCTACTCGCGCACGCCCAGCAACTCCGTATCCATAACCGAGGCCGCAGTGTACTCAGCCTCCATGGTGGAGAGGCTGACGCCGGTCTGCTTCT
TGCAGATCCACGACACGGGCATCCCGTCAACCGTGAGAAGGCCGCCGGTCACGGACTTCCTGTCCGTCTTGTCGACAGCGAAGTCCGCGTCGCTGTACGC
GATGACCTTCAGCGGCTCCTCCAAAGCCCCATGGCCCTTCATGCTTATCCGCAGACTCTTGGTCCCTGCCAAGTAGCGCGCGATGCGCTTGCCGAGCTTC
CAGTCGGACATCGTGGGGCTGTGGGTGCGTCGGGACGCTTTGTGGACCGCGTACGCGATGTCAGGGCGCGTTCCACGCGCCCTGACACATAAGGCTCCCC
ACGAGCGACTGGAACTTGCGTACTGTCACCACACCATCTCCTCCAGTTGTGGACAGAAGCTCAACTGACGCCTCGTCGATCTCGTTCCACTCGGCGCCGA
TCGGGGTGCGCACGCTGTGCACTAACCCCATCCCGTGCTCGCGCAGCATCTCCTCGATGGCCAGCTCCTGATCTAAGTCGTAGCCCTCGTCCTCGGCGTA
TGACACCCTCATGCCAAGAAACTTGCTGGCGGGGCCGAGGTCCTTGATGGAGAGCTCGGTCAGCTCGCCGAAGAACGCGTCGACGGCTTGCTGCTGCATT
CCCGTGACCAGCAGGTCGTCGACATACACGCCGACAGCCACCAGGATGCCTTCCCGGCGCCTGTGGTACACGCACATGTCCGTCAGACTCTGGGCGAAGC
ACAACTTGATGAGAGCCTTGGTTCCAGAGGCGGGCTGCCTGCTTGAGGCCGTACAAAGCCTTCAGCAACTCCAGCACCAACTCGCAGTCGTTGGTCACGC
CCAGTTGCTTACGCACGTCTTCTGGAATCACCATTCCGCGCGGCAGGCGCAGGAAGATGTCCAGCTCCGCCTGCTTGTCGGCCTTGACGTACGCGTTGGG
CACGTCGCCGTGCTTCGCGGGGACTCGCCA