Description :
From Genome Similarity Track
Location :
Scaffold_390:174- 2007
Transcript NameFunction/comments
Sapdi_VS20SDRG_17448hypothetical protein

Sequence
830 bases(100 bases per row)
ATCGAAAAGCCGACGCAACCGGTCGTGGTCGAGCACCCGTTGCAGCACTGCGCGACCTGCGCTGCCGTGTCGCCGTTGACGCCAAAGCTGCGGATGTCGT
TGCCGTAGTAGTCGACGTCGGTGCTGACGCTGCTCCCGCACTGGCTGGACGAGCCCGCAGAGGCGCCGGGCGCAGAGGCCGAGACGACGCCAGCGCGGGG
CGTCGGGCTGCCGAGCGTGTGCTTGAGCCAGCACACACCGCTGTTGATGGAGAAGCCGGCGCAGCCGTTGGTCGAGCTGCACGCCGCGCAACACTGGCTG
AGCTGGTCTTGCGCACTGCCCCACACCCCAAGGTTCTTGATGTCGTTGCCGTAGTAGTCGAGGTCGCTCTTGGCGTTGGCGCACTGGCCGCCGCTGTTGG
GCTGCGGCGCGGGCCCCGGGTTCTGGCCGTTGCCTTGCAGCGGAACGCAGTTTTCTACGCACAGTATCGCAGCGTGAGCCATGGAGCCATAAAGGTCGTG
GGACGCACTGTAGACTTGCCACTCAGGCTGGTGTAGCGCAATCCAGTAAAAGCGCAGCATGCAGCCGTCGCCCGCGCAGCTCGAGTAGTCGACGGGGAGG
TGCGCGGCCGGCTTGTCGCCAAAGTTGGTCGCGCAGTCGTCGTTCTGAAACACGCGCTTGTTGTCGAGCCACACCTCGCAGGGGCCCTACCAATGAGTGC
AGCTTGAGTATACATAGAGTAGTGTCGTTGGGTACCGTGTGGCTCGGGATGAAGCCTTCGCCCGTGTCGGGGTTCTGCCACGTCATCTTGCCGTCCGATG
GGATCGCCTTCTTGGCGACGTTGGTGAGCG