Description :
From Genome Similarity Track
Location :
Scaffold_277:174- 1204
Sequence
1030 bases(100 bases per row)
AGGAAGGCAGAGGGGCACACGTCGGTTGTCATAGTGTATTACACGCAGGAAGACGGTGCCGTGACTCATGTTGCGTGCCGTCCAGAGGAATGGCGGCGCT
GGGTCGGACAGTGCCGGGTGCAAACCTTGATGACGGAAGCACTACATATTTGGTGCACCACTGTGTCGAGATGAGCTGGCAGCACGAGAGCGCATCCGTG
CGAGAATTCTGGCGCCAGCTGCGCCACGAGCGTGTATGCGATGCGGACGTTCCGAAGCAGCAAAAGCAGAGTGTTGGCCTCCAACAAACTTGAACCAAAG
TCACTTCATTTTTTCGCGGCCTCGTCCTTAACCACTTGTCGAGTCTTTTTTCGCTCGGTTTCTAGCACCTCTCTAATCCTGCCGCACACTCGTGGAGCAG
CGCTATGTGGGCAGCGAGGGGCCTTGGCGATGCAGCGCGACGCCGCCACATCGAACACGCGCGGTGTGATTATAAACACGCACTCGAAATCGTGCGAGTA
GTGGGCGAGTCGTGGGTACCTGCAAGGTCATACCTGGCCACAAGAAAGCGCGGCTTTCATCTTTCCTTTGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN