Description :
From Genome Similarity Track
Location :
scaffold_10:1739775- 1741090
Transcript NameFunction/comments
Plaha_PHALS_11874hypothetical protein F443_03694

Sequence
1315 bases(100 bases per row)
GTCGCGTTTTCACGCCCAGCACTGTTCAATCACTGTCCTCGTCACTATCTTCCGACGATGACAGACTGAGTGAAATGGTATTTGGGGCATCGTCTTCACT
ATCGCCCGATTCACTTGAACTCTCACTTTCGGCCGAGCCAGTATCGCGCTCTTCCACTTTGCGTTTCTTGCGCAATGTGTCGACGTCATCCACGATTTCA
TCGTCATATAGTGGTACACGTTTTTCAGGTAGCTTAAATTTCTTGCGTAGAATCTCCATGGCATCCGACGGAAGTGGATCTCCCGTTTTCCACGACTCTG
GCAATGTTATTCCATGTTCAATGAAAAAAGGACGACCCATGTAATGGAGCAAAGCATCGAGGGGTAAATCCACGGGATCTCCAGGTCTCCATCCCGGTGG
CATTTGTTTTCGGATTTGTGCATCACTTGCACCTAATCCAATAGGAATTTCGAGCTTTTCAATAGTTTCCTTCTCTCCTTCTTGCTTAACTCTCGCAGTA
CTTGATGTATACTTCTCAGGCCCTTGCGTCACAATCTCCGCTACGATACCTCGACTAAGCACGCCCGCACGCATCATGTGTTCTTGTGGTGCTGGTGGCA
TAAATCCAAACATTGGAAACTGGACTATCCAACATTAGACGGAGTCTCATCAGTACATTAAAATGAATCACGTACACCAGGTTGCCATTCTTTTGGCGCG
GACGTTGTGCCTGCAATACGGTGTGCATACGCAATAACATTGCGCGGGTCCAATttgactgcattgcgataaATGAAGTAAGACGACAATCAGTAGCATA
TCGTGAGCTTTTCCGTCTCTTACCTTGAACTTGACGCTTCGCGTTTTGCAACACAACTTGATGCTTTTTCAATACATTCGCAATATTTTCTTGAGACTGA
CGTAGCTGTGCTGCATACTGAATCACCTTCTGTTCCTTTCCCTTAATCTCAGCCTCAATGCGAAGTAATTCTTTCTGTGTCACTTGGTGTCTTGCCACTA
CAACGCAATACTAAGTTCGCACGCATCTTAAACTCTCGTAGATCAAACGTACATTTTTTCACAGTCACAAGTAAATCGCGATCTTTTTCTAGCACTTTGT
TAAATATCTCATTCACTGTACGTAGTCTCGTGGCTGTAATCGTCGTGGACGGAGGCCTACGGTCATGTAGCAAACAACATTGTAAACATGGAATATACAA
ATCCATATGCAAGGGATAAATTCCATACAAAGAGGCTGTGTAGAGTGACTCAAGTAGCTTGGTTACTAGATATCGGTGCTCGTGGAGCACCACCTCCATC
TCCTCGCGGATGCTC