Description :
From Genome Similarity Track
Location :
Scaffold_424:17396- 19045
Transcript NameFunction/comments
Phymu_g9770hypothetical protein

Sequence
1649 bases(100 bases per row)
CACCGCCGACTCGACACTGCGCGTAGTTCTCTGCAAGCCACTTAGCCACCACGACATGACCGCCCACCAAAGCATCCCGAACAGCTCGTCTTGTGCACCC
TGCACGTCCGTTTTCATGCAAAAAGCGTATCACTTCCAAGTGTCCGAACCAAGCGGCTCCGTCCATTGCTTCAGTGGAACATCCCTCACTTCGGTTCTCG
AAAAGCCATTCTACAACGTCTAAATGTCCAAAACGCGCTGCAGAGTCCATTGCACTGTGAGAACAGCCTTCGCTCCGGTTGAAATGGAGGAATTTCACGA
CTTCCAAGCGACCAAAACATGCAGCTGCATCCATCGCCTCCGTCGTGCATCCCTCGGACCGATTCTCGTGAAGGAAACGCACAATTGCAAGGTAACCCGC
ACTTGCTGCGCGATCAATTGCCCTCTCCGTACACCCCTCCGTGCGATTCTcgtgcaggaacttgacAACATTAAGCTGGCCACCGCCTGCTGCCGAGTTC
ATCGCCCAGGGGCTGCAACCTTCATTTCGATTCGAATGCAGGAACTCTACAACCTCCAAATGACCTTCAGCGGCTGCGTAGTCCATTGCCAGGTACGAAC
AGCCTTCCCTACGACGCTCATGCAAGAACTTTACCACTTCCAGGTGTCCACCTCGAGCAGCGCCGTCCATAGCGTTGGTGGTGCAACCTTCCGAGCGATG
GtcgtgcaggaactggacAATCTCCAAGTgtcctcctcgagctgcacCATTCATTGCGTCCGTTGTGCATCCGCCAGTTGTATTGAcatgcagccacttg
accacgtCGAAATGTCCGTATTCCGCTGCATGGTCCATGACCAGAGGTGAGCTGTCGTCTGAGTTGGGGGCCAACAGTTCTTCTTTGTGGTCGTAGagcc
acttgagcagctcgagatcTCCACGTTTCGCCGCGAACACCATAGCGTGGATACTGCAGCCTTCACTACGATGCTCATACAGCCAATGCACCATACGAGC
GTTCCCGTACCACACTGCAAAGTTCATGGCGTATTTCGTGCCGCCTTCGCTACGGTGAGCAGCCAACCACTGTACAACCTCGACGTGTCCTCGAGCCCCC
GCTTCGTCGATAGCATGATGGGAACACCCCTCACTCCGGTTttcatgtagccattgtaCAACTGCTAGATGTCcgtgtgctgctgccaagtcCATGGCTT
TGGTAGTGGCTTGCAGATCCGGAATGGTcttgtgtagccatttgaCACATTCCAGTTGACCATGTTCCGCCGCGTGGTCCAGTACTCCGTCGTAACCTTG
GAACTCGGGGTCGTATACTGCCAGCCACTGTAACAGTGCCATGTCGCCTCGCTGGACTGCAGATAGGAAGCATCTACGGTTCGACAACGGTCGCAAACGT
CTCGAAGTGGCgcccagacgctgcaggagatgcagatAGCAGTAATCCAAGGCTTGCGGGATGTTCCAGAGAGCGGAATTatccaagaaggaggagatca
gTGCGGCCACGTGTGGGAGGAAGCCGAGAGCCTCCTGCTCGCGCCATACGACGTCCACGCACGTGAGCAGTGGCGTCCCAGTGGAGACCATGGGGAGCTT
TTTAGACTGATTCGAGTCTGAGTCTGTTCAAAGCCGTGACGAAACGGTG