Description :
From Genome Similarity Track
Location :
scaffold_40:173957- 175080
Transcript NameFunction/comments
g2162.t1hypothetical protein

Sequence
1123 bases(100 bases per row)
GAACGGGCAGATGCGTCCGTCATTCATGGTCAGCGCTTTGAAGCCTTGTACTGGCACCCGCGCCGAGCCGGTTGTGAACTGCAGCAAGCGCGCCTTTTGC
TCGTTCGTGAATTCATGGACGATATTCCAGAACCAGGCGATAGCTCGCTCGTCGCGCTCCCCCACATAAATAGTGTGAGTCTTCCAGTCCTGCACGTCAA
TGTCGGGGATTCCACAAATCAAGAGCTCCAACTCCTGGTGGTCGAAGACAGAGATAAGCTCCTTGGGAATAATTGAGAAGAGGCCCTGCATCAAGGATCC
CAGCTGCTGCGATATGCTGTTTGCAACGATCCACTTGAAGCGCAGGTTGACGTACTCCATCTTGTTCTCTTCGGTGACGGGGATGTTCGATCCGTTTGGT
ACCAAATCCACCACCTTCGCCTTGTCAGACATTTGGTCGACGTTGACACTGGAAATGCACAAGACAATTTGTTAACATGACTGCAACTCAGTGGCTTGAA
ACAGAATACTACGTACGTGAAGTCCAGGGCCAATGATTCTACACCCGTGTTGTCTCGCAACCACTTCAAATTCTTGTACAGGTCGTTGTCCACGAACTCC
AAGTCCGAAAACGTAATGGGGATACCCAGAATATGCTTGCATACCGGGAGTGCCAAGTGTGCATCGATGAGGATACCTTCGAAGAGCGCTCTACCGATGA
AACGACCAATTGCTTGGTAGTACTGCACACACACACAAACAACTGTAAGAACACACCAACACATCGACAACTACCGCAAAGCGTACCATCAGGTGGTCAA
CACTGGCTTCAGCGGACGCAGGATTCACCATGAGTCCATCTCCGTTACCGCTTCTGTAGAACAGCCCAGTAGCATCATCGAAGACCTCCTTTGTCATCAG
CGTAAACCATTCGCGGACCAGACCACCTGCATCCACGCCCGGCTCGTTCGCGAACTTGATTCGAAGAGACTGGTGCAGCTGATCCGGGGTCGCCCATAAA
AGCTGTTCGCACGAATTGTGGAGAAGGTTGTCACGCTCGATCTCCAGCAACAAGTGCCCATACTCCCACGGAACCTCCATGGCAGCCGTGTGCTGCACAA
ACCACGCGTGCTTTTGCTGGAAG