Description :
From Genome Similarity Track
Location :
Scaffold_37:173911- 199881
Transcript NameFunction/comments
Phypa_INRA-310PPTG_13841ATP synthase subunit beta, mitochondrial
Phypa_INRA-310PPTG_13842hypothetical protein
Phypa_INRA-310PPTG_13843protein phosphatase 2A regulatory B subunit
Phypa_INRA-310PPTG_13844hypothetical protein
Phypa_INRA-310PPTG_13845hypothetical protein
Phypa_INRA-310PPTG_13846hypothetical protein
Phypa_INRA-310PPTG_13847hypothetical protein
Phypa_INRA-310PPTG_13848hypothetical protein
Phypa_INRA-310PPTG_13849hypothetical protein
Phypa_INRA-310PPTG_13850fumarate hydratase, mitochondrial
Phypa_INRA-310PPTG_13851hypothetical protein
Phypa_INRA-310PPTG_13852UDP-N-acetylglucosamine-peptide N-acetylglucosaminyltransferase

Sequence
25970 bases(100 bases per row)
TTACTTCGACCAAGAAGGGCTCCATTACGTCGGTGCAGGCCATTTACGTGCCCGCTGATGACCTGACGGATCCGGCTCCGGCCACCACGTTCTCCCACTT
GGACGCCACGACTGTGCTGTCGCGTCAGATTTCCGAGCTGGGTATCTACCCGGCTGTGGACCCCCTCGACTCCAAGTCGCGTATGCTTGACCCGCGTATT
ATCGGCCAGGAGCACTACGACGTGGCCCGTGCCACCCAGAAGCTGCTGCAGGACTACAAGGGTCTGCAGGACATTATCGCCATTCTGGGTATGGATGAGC
TGTCGGAAGACGACAAGCTCACCGTCGCTCGCGCCCGTAAGGTGCAGAAGTTCATGTCGCAGCCGCTGCACGTGGCTGAGGTGTTCACGGGCAAGGCCGG
CAAGTTCGTGCCGCTCCAGGACACGATCTCGTCGTTCAAGGACATCATCGCTGGCAACTACGACGACCTTCCGGAGGCTGCCTTCTACATGGTTGGCGGT
ATCGAGGAGGTCAAGGCCAAGGCTGCTGAGCTGGCGGCCGAGCTTGACGAATAAGTTACTCGGTTCGAAATGCAGAGCGGAAGATAAGCAACCCCTTAAA
CTCCTCCCCACCTCAATGGAAAGCGGCGTCTAGTGTGCGGCACGTGAGACCGGAAATTGAAAAAAAAAGCAACAACAGAACTCAAGCAGGCCTCAGGGTT
TGTAAGTGGACTAGCTTTCTTGTATTCTCTGCGTTTCATATTCGTTGTAGCCTCTGCCTTCCAATAAAGCAATGAAAAAACTTAAACCAACTTGTTTCTT
TCAAGGTCCAGGTAAAAAGCTGCATGCATAACAAGACACGAATTGCACGTTATGAAAGATACAACCTCGAAAGAATCGCGTCTGTTTCTCGGTTTATGAC
GATCACAACTGCGGCGTAGACAGGGGATCCGTCCATGGCCGATCACTTCTATTTTCTATTCATACTCGAAGTCCTCATCGAAGTCCTCATCATCGTCATC
GTCCACAATGTCATCGTCGTCCTCGAGCTCCGCAGCCGCGATGATTTCTTCGTCAATAGCCTTCCACTGCTCGGGCGTAGGCTCCGGGTATCGCGACAGA
TACGGCAGCAATGCCATTTGACGCGAGATCTTGATCGCCTGTGCCAGTTTGCGCTGCTGCTTGGCCCTCAGACCGGTGAATCGACGGGGACGAATGCGTC
CCGTGGGCGAAATGAAGAGACGCAGCAGCTCCACGTCAAGAGCCAACTCCACGACGTCTGGGTGGTTAGCAGCCACGAAATACTTCCACGGCTTGGTCTT
TTCCTTCCTGAACGGCTTCCTCTTCTCCGCAGGCAGCATCCAGTTGAGCATCTCCGGAGAAATACTGAATAAAACAATAAAAATCAATGAGTCAACACCA
TCAACAATTGACAAATACAAAAATCAACTTACGCCATGCCCTGATCCCACTTCTTGAACGGGTCAGGGACATTTGCGTCCTCGTTGACGCCGATTTGACT
CTCCGCGAGACTCAACGACGCGTCGTATCCAGGCATCTCAACGTAGAGACGGTCGTCCTCGACGTTCGTGGAAGACGCGTTGGCCACACTGTCCTCGTCG
TATTCTCCCTCTTCCTGATCCCACTCAGCCACTTCACGCTCGAACTTCTCGGCCCACTCGGCAGGACTGAGCTCGGCGTCCTCATCGTCCTCGTCCTCGT
CGTCAATGTCGATCTCCTCCGTGAACTGAAGGTCCTTCTCATCCAGCTGCTTACTCAGATACTTCACCTCTTCCGGCAGATCCGTCAAGTCCTCGTCCTC
CTCTACTTTGTCAAAGGTTGACTTCTTCTTGAATTCTGCAATAAGCGACGAATTAGCACTTAACTCGACGCTTTAAGTTCTAAAAGACGCACCTTTCTTG
CCGTCGTCCTTGCTCTTGGTGGACAAGGAGCGCACACCACCAATTAGAGACGAAGCGTCATTGCGTGCGGCCAATGAACGCGGGATCTGAGCGCGCAGCA
CGACAGTCTTGGCACTCGGAGTTACACGACCGAGCGCTGATAAGAACATCAATACACACAGACACAGCCATCACGTTGGTTAAAGAACTTGGCATCGAGT
TAACGCATTGGAACACATTGAGACGAAGCGTACCAGCGATCGCAGACGCGCAGGGACGAAGCCACACGCGCACCATTTGTCTCTTGCTGATCCTCCACCG
CTCGCTCGGGGGTTTGCTTCTGTGGTTGACAGTGGAGCTGTTTCGTCTATCTGGTGTGGACCCCGTCACTAAATTGTGATTGGATGAAAACATTTTCACA
TTAAAAATGCGAAAATCGTACCACAAAATTTGCGCTTCAACATGAAAAGTGAATCAAACGAACGGGTTCATGCTTGCTTCCTGTTTTCCTACCTGCTCAA
GACAGCACACTACGTAAAGCGAATGAAAAAGAAAGATACTAGTCCACCAGATTTGCATCGCTCGCCTGCAAAACCTGAATGCCCGTCATCTAAATGCAAT
CGCCGTTCATGAAAACCATGAAAACCTAACTCTGCCTGCCATCTCCTCTCATGTGCTGTTCTCCCGCGCTCGGCGCGAGGAGTGCTGTATGGGTCGCAAG
CAAAGGTCAGAGCCTCGCGCGTGCGACTCCAAGCCTCTTATTGGCCCCGCTCTCCTTCGTCTCCTCCTCCACTCGTCAACCTTCGCTTGGTCCAACTCGT
TATCATTCGCTGCTATTGTGTCCCTAGGCCGTTGACGAAGGAGCCTTCGCCGCTGCCATCGACTCTATTTTCCGCCACTTCTCCTGCTCTTTGTTCTTCG
TGTCCGCCATAGCTTGCTCCTTCAACGAGTATTCCTTTGCACACTGGTCATAGAGCGCCATATCATAGTCCATGTACAGCTTCAACACATTCTAAAAACA
ACACAACAAAACTTAGATAATAAATAAAACCCGACAACACAGCAAGCATACCTGAGCGAGTCCTTCGACAGTAGTGTTCCAGTGTCCCAGTGAGTTTCTA
TGGAGAGGGCCGTAAATGACCGGCAGGATCAAGTGCGCGTGCTGCTTACTCAAGCATCCATTGTTCACCAAGTGCTCATTGTTCCACAAGAACAGCGACC
GCTCCGAAACTTGAAAATGCTGACTACCAAGCCACTTGGCCAACCCGTTAAACAAAGGCTTGTGCACCTGTTGCAACTGCTCCGTCCCCATCAGCTCCAG
AATCTCCTCCAACTCGTTCAGGAAGATCACCTGCTTGGACGAGCACGACCAGGGCCAAAACTTGATGATGCCTTGAATAATCGGCACCGCCGTCTCGGGA
TCCTTTTCTACATACTGCGTGATGCAATAGGAGAGCTGCTGGTGGTACATTGATACGCACTTGGGCTTGTGCAGCGGCACCAGTGCACGCACCAGGAACT
GCAGATGTTCGGCCTTTAGCGGCATGGCAAAGCCATTGATGATACTACCGAGAATCTCCAAGAGTTCACCGATACCGTTGTGTCGCTCCGTCTCGTAGAC
GAATCGATAGAAAACGTTGCTGATGGCCTTGCGGATGAATGATCGGTGCGACATAAACTTGCCATAGATGCGGTGCAGGATGGTCTTGAGGTAATCCCGT
TCGCGCGGGTCCTCGCTGTCGAACAGGTCGATGATGGCCAGACAGAACTTCTGGTCCACGTACTTCTTGGCGACCTTGGCATTCACCTCGCCCGACACGA
TGAAGCGCAGGAAAAATTCATACACCACTTGAAGATGTGGCCACGAGGCTTCCAGCACGGGTTCGTCCTCCTCCGGGTCGAAGTCTTCGGTCTGCGGGGG
CAACGCACGGCAAATATTGACCGATACCATCGCCATAATATCCGGCATCAACGTTTCCGTGAAGATCTTCTGGCCTCCGGGGTTGTTCACATAATCTACA
AGTTCCAGTAGCGTCTGGCGCTTCAAATCCTTGCCCCTGATAATAAGACCCGATAGGAAATTATCAGATTGATAAAACCCACATGATAAAACCCAAGTTT
GCCAGCTTACCGCTTGTCCGACGTGGGGTCGTCAAAATTGAAAATGACCGAGCACAGCTCCAGCTTCTGCTGGAACAACGCCTCTCGCCGCTGTAGCGAC
GTGTCTTTCAGGTGTGGCAAGTCCTTCAGCGCCTGGATCTTCTGATTGCGCGCCATGAAGGAGCGGCGGCGCTCGCGCTTGGGCAGCGACACGTCGGAGC
GTGCCACGTCGCCCACAGGCGAGCCGACGCCGTTGGCGCCCTTGGGGGCTCCGTCAACGTCCATCCGATCCGGCGAGTTGGCACCGATGTGCTCTCCGTT
GTTGCTAAGCTTCCGTTTCACCGTTTGCAACATCCCCTTCATTGCTTAGTTAGCCCGCCAGTGTAGTCGTATGTAGGGGGCTCAATCACCCAGCGGACCC
AAACGCGAAATCAGGTCGGTCGTCCACGTCTAAATGTCTGTCGAAAGGCAAAAACAACAATGAGAATGCGAACAGGCAACTTTTTCATCCGCCGATTGCC
ACTTTTGCCACTTTGCGTCTTGACATTTCACTTTTTTCAAATGGCAAAAAAAAAAGCGAAGAATAGGAGGCGAGACTCCCTACCGGCCAGGCGGATGGAG
ATGGCGGAGCCAGGTCCTGACGGGCAAGGATACACGTACGCTGAGAGGGAGGGCACGCACTCGAGCTGCAACTAACCTTCAGTGACTAGTGCGGGCTTGA
GGGCGACTGCGTGCTTCTGACCGTCCGCTGGTTGCCTTGCGGTCTCTCAGTCGCGTTTTCTTCCTTCCTTTTCCTCCCCCCTTTCCCCCTCCACGCACAT
AATAATTACATTTGTAGCCTATCCCCGTCTATCGCGATTGGATTCGATACAAACGTCAAGTGAATCGCAGGTGAGAGGGGGGATGCAAAACCACATGGTT
GAGTTGAATTAGCCTGCAGGAATAGCAGTCTATGTGGCAATTTAGGTATCAATTTACGCATGGAGCGCGAGCTGACGCGGCGCTGCCGACGCAGCGTGCG
CGTGGCTGAGTTCGTGGCAGTGGACGCCCTTAGCACTATCCGAACTGGCGGCGACGTAGCATCCAGTACAGAGCGCAAGACGCCGCTATTCGCAGGCTAC
GTGGAGGTTCTGTACGCACGCAACGCTTGGCTGGTAGCGCGCGTGGACATCTGGACGAGCAGAGACGTTTGCCACCGCCAAGGTTGGGCAGATGGCTATC
AACGTCGCCATGGACAATAATTGTTGGCCAATGTATTTTTATTCACTATTGTTAACGTGTGTTTTGGCAATCTTTTTGCAGTCAAGTTTTCGAGCGTGTA
TGTGCAACAAAATGAAAATGAAGTGTCAGCAGTTGCAGTGACAAATGGAGGTGGACTGACTGCGCTGCAAAACGTTGAAAAAATCGCTCTAAATGTGGCG
GATCGAGGTGAAATGCCGGCATTGACTAACGACGACTTGGCAAAAGTACTGGAAGATGTGGTCAAGCAACTCGTTGATGTATTCCGCGAACAACAAGTGC
AGGTGAGTCAGCAGATGAAAAGTGGGAAGGCATTGCCACCGCTAATCGTCACTTGTGTTGTTGTTGCAGACTCTGCAGGCTGCAACATCACAGCGGGCGA
AGTTCGAGTACGAAATGCTGCAACACCGTCCTGAACTGGAAGTGCTGGTGATGAGTAGTGAATCTACTGGCAACTACGTGTTGTTTGCGTTGCCGTTGCT
TGGAGAAAAGCCTCAATGGGATCCGAAAAATTTGATTGAAGCAGAGGATCTGGACTCGGTGTACATACCTGACGGCTTCCATGCGCCGAATTTCTCAGTT
ACAACCAACGGATTGACAATTTTCATCGGATACCCAATGAAAGAGGAGGCAAAATCTGATGCTGCATGGCCACTTTTAGTTGAGTGGCCGGCTAAAATGT
TGCTGTCGAGCCAAGTAACGCAGACTCCACCGTCTAGTAAGGGCCAATCTTCGGTAGAGCTCATCGCGTCTTGCAAAAAGGTGAAACATTATCATCTTGG
TCTCAATACAACTGTGTTGCTAGTGCTAATTTGCATTTGTGTAGATGTTTTTGCAACAGTGGAGAAGGCGTAAAGATTTTATTGCTGAGCTGCGTCGCCA
CGTGATAGGTGGGTGAACTGACGTAGCGTTGATGATGAAGACTCTGCGCTAACGTTTGCTCGAACTGTAGTGTTAGAGTACGATGCTGTGGATTTTTCGC
AGGTGTTCTTCATGTTGCAGGAGCAGTTAAATGACCAGGCACCACTGCGTATTCTCGTCCTTCAGCTGCAGTTTACAGCAGCGTTTTTCCTCACGAATTG
CATGAGCGACTTGCAAGTGGTTTTACTCGACGGTGAAGCAGATACAGCTCCCGTTCCAGTAGCGCTTGCTGCCTCCAGTACTCCTCCCAGTCCCGACCCT
ATTGCACACAGCCAAACGTGCGCCTCTCAGTTCCTCGAATCCACACGAAAAAGTCTGCTTCGACATTTTTACGGAGAATGAACCCGACTCAGACGGATAT
TGCGATCATAGAGCAGAAATATGAATATGTAAAAGAGTCCAGTGAACAGTTTTAGTCTGGTGCTTTACGTTTGGTGCATGTCTTGCGGACCTAACATGCC
ACGCTGTCAAGGTTCAGCACTAGATCCACGTTATCCACATACAGGTCGCGCTTGTCAACGTCACAGATTTCAAGCGCTTTGCTGCCGCGTCGAAGCACTT
GCTGCAATTCCTCGTCTACTTTGCACTCGTCAACGTGCAAAGTTCTGCTATATCTCCGAGCCAAGACCACCATCTCTCTAATCGAGCGGATACCTTGCTG
CTTCGCCATCCAAATAGCTCTATTCGTCTGCAGACGACACCTTCAAGTTGCAGCCATATCTATGCACATGCCTTGCATTCACGGTTGCACATGTCACCAC
TGCAATGCTTACCAACACTGCAACCTGCACAATTCCACCGTCACAACTGCATTTCCCAAGTCGCGCCTACTCGCAACGACCCCCCAAAGCAGAACCTTCG
ATCTCCCTCTCAACGCCCAATGCGTGAAGCCGTCCTCACACCTGAAGACGAAGAGTATCTAACGCTGCTGGAAGCTCGCCGAGACCAGCAGTTCACTACC
GCCCCGTTGCTCTCGGGTTTTCGGGTATTGGCACTCTTCTCGTACGAAGATCTCGATGGCCAAACCGACAAGTTCGTGATCGGCGCCAACGCCGAATGCG
CCAATATCGGAGGTGCCACATGTGCTGAACGTGCCGCCATGGCGCAACTGCAACTTTTGCCAGTACGTCGAGTGCGCAAAATCTACATCGTGTCGGATTC
TCCGCAGTGTTTAACACCTGGAACGCTGTGCCGCGAGTTTTTGCTGTCCAGTCCGTTGGTTGAGGAAAGCACGCCGTTCGTGTCACGAGCTGCCAAGTGC
CGCCCGTGTGTCACCACATTGGCGGAGCTGTACCCATTCCCGTCACTCTATGACCGAGTGCCACGTTCTCAAGTTTTGCCGTTCGCGCGAAAATTCTGTT
CACGGTTTGCCACTGACTTGCACGAAGAAGGTGAAAATGCTGACTTGCAACAAGAAAATGAAAATGTGACGCCATTTGTCAGGTTGCAACTTTCGCGGAT
GACACCAAATGAAAAAGAAGTTTATCTCAAGGCGCTGGCTGCAACGGAGAAGGATGCACGCGACGATCTGTTCCCGTTGAGATATGCTGCCGGCACGAAG
TTCTCCGATGGAGAAGTGCGCGTCACGTGGCAACACAAGACGCTGGAATACGGCAGCTCACTGGACGCCGTTTCCAAGCTCATTCCGTTCGTCGAAGCGA
AGCAAAACTCGATCAAGCCCCAGTTCTTGATGCAGGTGGATCAGTTTGGCATCCTCCACGCACCTTTTGCACGTGCACGGGCGTATTTCTTCGAGTTTGG
CTTCCTCGACGTTCCAGTGTTGGTCCATGACGCAGAAGGCGCGCTGCATCGTATTCCCATTGACATTCTCGTGGCCGATTCGCCGGATTGTATTGCCACT
TCCACAGCAGCGGTACAGTAGTCTTTAAACCTACTGACATCGCTACTATCCAGCTCCACGAATCTCGTTCATGCGCATTCGAATGTACACGCGCATCTGC
TGGAGCTGATCAGTGGAAGCTTGGTGGAACTACAGATAAAAAAAAAAAAAAACACGAACAGTTTCCTTGAAAATCGGATTCTAACCAGAATAATATAAAA
AAAATGCGATCCAAAGTTTTGCCAACTTACCAGAGAAGGAAGCAGTTCGCGAATACTGACAGTGCCGTCGGAATCGCGATCGAGAGAGTGGAAGAGATTA
TCAATACTCGTTGCGTTGCTCTCCAGACCGCAAAACTCCACCAACTGCTTCCATTCCTGTTGATCCAGATCGCCCGAGCCGTCTTCATCTAGTCGTGCAA
GTCGTACGGCGAGCTGTTCAACTTGCTTCACTGTATAATTTGGTCCAAAAGGGTTTTTCCCTTGAGCAATCGCGAGCGCCAACGCCTGATGACGCGTATT
TGCCGATGGAGAATCGGGTTTCTCCTTTTCACTGTGCTCTTTAGACACTTTAGGCTTCGAGCTCATGAGACAGACATTTGCCACGATCTTCTGGCACAAC
TTCAGCTTGCGTTCGATATTACTACTGCGAATTTTCTTTTCAGGACCGGAAGCCGGCTCGGTTGCATTTAGCACAGGTGCAGACGCGCTTGAGCTTAACG
TATGTGAAGACTCGCCAGGTTCTTGGCCTGGAGACTGCGCCAGCTTCGGTAGTGACACATTTCTCGCTAGTATCACCACACTTGCATTCATCTTGATGTC
GATTTCTGGAGTGGCAATCGGACGTCGCAAACGTTTTTTCGGTGTCGATTTCACAGATTTGCCAATAGATGACGCTGCGTCCTGTAGTTTTTCACGTAGA
AATGGTGAAGGTTCCGGATCAAAAGCGCGTAAAGCACTCGCCGAAGCTTTTGCATTAGCAGCCGCGCGACGTTCGAGTTCCAATGGATAATTTGTAAGTG
CTCGAGATGGAAAATCCAAAATCTGCGGACTATTGTTCATCATCGCGCGAGCCTTTGCCTTCGCTTTAGCACGCGCTCTCCCCATTTCTTCAGGCGAAGA
AAACAATGGTGCAAGTGCTGCCATACGCTTCCGTTTGTCGGAGACATCCAACAGTAAGGCCTTGGATTTTTTCGCTATGGAACGGAGATGTTGCGCCTCC
TCCGGTCCAAAAATCCCTTGATGAATTCCGGACGTGACGGATGTCACGGAAAATGGTACTTGTGTTACCAAGGCGTTTGCAGCGTTAGTCATCGCGATAG
AAGCATCAGGAAAGCCCGAAATTTGAGGTCCAAATGGTAATTTTACCGTCGAGTCAAGCTCCAAAAGTGACGAAGGAGTCGCGAGCGAGTTTTCAGAAAC
TGGTTGCTCATTTTGAGGTTGGTGGCCTGCTTTACGTTGACGACTGAGCTCCTTCTTTAGTCTTCGTTGGTGTTTAGCGATAACCTCTTTCGCAATTCGT
TCAAAGAGATCGTTTTGAGTTCCAACAGTGTGATCACGACGTATAAATTTCCACGCAGAAGCCGAGGCGGAACTCTGTTCTGCTGTGGTTAAAATATGGC
CAACACAGGTTGCAGTGTGGTCCCAGATTTTAACTACGCCGTCTGCACCTAACGAGAGCAACTCACCAGGCCAAGGTACGCTTTGCACAGATAATACGCC
AGCTTGATGTGCCATCCAGGATTTAGTAGATAAAACCACTGGCAATGGTGAAGTTTTACCCAAGCTTTCCAATATTGAAATTTCACCTTTAGAAATCGAT
GAACGACGGCGAATAGCTGAGCGTCGTGTGGGTTCTGACTGGGTTTTAACTGGGAGAGAATGAAGATTCCAAGCAAAAATCTGTCCGGTTTCAACGCCAA
CGTAGAGCATTGCGACCGAGTCTTGAGAATTACTGGAGCATATTGAAGTGATCCCGTCGAGCTCAATTTTATTTGGCACAGGTCTTAATGGAGCCATTTC
TTGCATTGTGAGTCGCATTAAAGGTTGTGCGATAGTCGATCGGACTCCAATTGTCGGCCAAACGAAGATGACACCACTGACATCGCCTGAAACAAGGAGT
CCAGGTGTAGCAGATGGAAAATGTAGAGCTCGAATCTCTCGGGTGTGGACGTTAGCACAACGAAATTGGAACGTGATGTGGTGGAGATCGTGCACTTGCA
CTCCGCCAGAATCGTCCGCTGTAGCGATGAACCTCGACGTATGAGAATCAGTCGGTGGAGGCGGTGAGCAAGCGCAACAAGTGATGTTTGAATTGTGAGC
CTTTTCCACGTAATGTATCACTTCCAGTTTTAATTTTCCAGGTGGAGAATCCACAACACAAATCATTCGATCGTCTCCAGTCGAGACCAAACACTGCAAA
AAATAAATAGTTAAGTTTCTGGTTGTTCAAACTGCTCGAAATAAACTTACATCGGCTTGAGAGCAGAATACAAGGGAAGTAACAGTGCCGTCATGCACTG
CCAATTTCTAGAAAAATACAATTTGTCAAAAGATGATAATGAACGTGACAGTACACGTACATATCTTACCTGCAATAGTGCCCCAGTCACGGGATTGTAC
AGCCGAATCGCCCCATCCTAGGACGTAAATTTAGCCAAGTTAGGTTTGCAATAGACCGCAGATACATACATTCTCATACGTACATTAGTTGCCACGAAAA
GTTTTCTTTCACGAGGACTATCAAACGTGATAGCACAAACTTCCGCGTCTCGGATTGACACTGGTTCTTCAATTTTAGCACCAGAGTTTGCATTCCACAC
CGTAATGCGATTCTCCACCGCACCAACGAATGTGTTGGCCACAGCATTAAAAACGACGAACCTCGTGGGCGCTGAACCTGCCGATTCATCAACAGTTGAA
TCTTCTTGTGACCCCACCGACTGCGTGAATGCACTAAAGCGATAGAGCCGTAAGTTTCCCGTAATAATATCGCTCGCAGGGCTCTCAGTCGAGTGAGTTC
CTGGCTCATCATGTTGTGATTCAGGTCCAATAGTTCCACTTGATGAGGTCATAAACATCCGAAAACGACAGAGATTCGGCGTGTGAAGCTCAAAAGTCTG
CAACATTATCGACAAATGGCTCCCAGAAAATCCTTTGGCGCATCGAGTGATGTCCCAAAGCTTGAAATGTCCACTTTGATCGCCCGTGACCACAAGACAA
GGCCCAGTTGCAGAGGTTGACACAAATTTAGCCCCCATAAGACAATGGTGATGACCTCCTAGTTTAGTCTTAAGAACACGTCCAGAAATCCCCCAACAAT
AAGCTTGGTACTCAAATCCTGAGCTTAGTAGTAAATTATAAGCAGAATCAAGCGTCAGCACCGCTTGCTGGTGTCCTCGAAGCACGAAAGACACGGTTAA
CACAGCGGATGGACCACCAAGAGCGGAATTGGCACCTGCCACAGTCTCCCAGATCGTGATCGTGTGGTCAAATGATGCCGTCGCGACGTACGGAGTCTCT
GGTAGGTCTAAACAAGCAGCAATACGCTCACTATGACTGCGAGGAAGCAGCATAGGCGGAGGTGGCAGTGCAGCCCCAGCGTGCATTGGCACTTCCAAGT
CCCACAGTTGAACTTGTTCAGTTGATCCACCGGCAACAAACAAGCGCTTGAGAGGAGGAGGACACCACTTGACGAAAAGAGCAGGAAAACGTCCTGCGAG
TTTCCCGTTGAAGACATAGGAACCCACAGTGGCGTCGATAATGGACCATAATGAAATACACAAGTCGCTACTTGCCACAGCCAAAGCATTTCGAGATGGA
ATGTGCTCTGCGTCCAGAACTTCCAGTGAGTCTAATACATCTTGCTGCTTCTCGCCTGCTTTCTTCTCTGCTGCGAGTTTCTCACTGCAATTGAGTTCGT
GGAGGAAGTTCATGTCGAGGTCGAAAAACTAGAATCAAGAGTACGTAAGGAAAAAGTAAAAAGTGTAAATGATTATTTTTACGCACGAGAATTCGCGGAG
ATTTGTGTTCGATCACTGCGAGGCGTTTTAGTTGGGAGAACGTTTTGAGCTTGTTAATTTGGTAAGGAAATGTTCTGTAGCGCAAGATTTGTAAGTACAA
ACGAATAAAGTTGTAAAATAAAAAAATAACTTACCGAGTTGCCGTTGCGCTACTCAGAGGTTCATGACGATACACTATCATATTTCGAGGTGGAGCGTCG
TGATTATCTCCATGACTTTGTCCTTGATCATGATCATTCTCGTCGTGAGGAACTCGTGTAGCAACAAGTCCCAAAGCAATACAAAACGACGTAAATTCGT
CCCAATCCACGATAGAATCTCCATTAATATCGATCTGTTCAAACATCTCAAACAATAATCCAACAAGAGCTGTAGCGCGTCCAACATGCTGCATCAAACT
CGGTCGAGCACGCATCAATTCCCATAGTAACAAGCGCGTAAAATCCACTTTAGACAGTCCTGCTTTGGGAAAATGGCGTTCAATACCCAGAAATTCGTTG
CAACTGAGAGCTGCACAGATTCCGGCGACACTGGATAACGGATTCCGATTTGGGATTTTAATGTCCGGTATAAGATCTAACAGGAAAATCTGCATAGTTT
CAACCAGAGACGCTGTTACAGCACTGCGAACCACAACGTTGCTTCGTTCCTCGGTTGCAGCATGAAATGCCCAGTCGTGATGTTTACCGTGTCGTCGGAA
GAATTTACATAATATCACGACATTTGTCTGTTTGCCAATATTTCTTCTCAATGTCTTCGGATCATGAGAAATATCCAATAAACGCGTGCGTTCTCCAGTG
TCATTAAACACGAATCTCTTGCCTCCAGCCGCGAGCGCTTGTGCTTGGGCTTCGGCCTGAGAGCTGTCAACAGCGTGGAGATCGCAAGTGAGCGAGAACG
CGTTAAGTTGAGGAGATCGAGCGATTTCGTCCTCTGAATAAGTGACTAAACAGCCCACGACTTCGACGTATGGATGCAGCTTGGCCATGGAGAAGCGAAC
AACTTCACGCTCGTCGGTCTCTTTCAATTTGGCTCGAGTCGCTCGGAAATTATCCTCACCAAGATATTGGACAGAGTGGCTATTAGCTGTGCGATGATTT
GTTGACGTGTCCGGACTTTTAGCACCACGAGCGACCTGCAAAATGTCGCCCTGAAAAGCACAAAACGCGGGTACTTAACGTACAATAAATCCCCAAACGA
AGCACGACCTACCTACCTGTGCATTGAAAAGCAAGAAGACCAGCTCGAGAATCCACGGCACTTTTTCGTCTTCCTCTCGTCGAAGTCGCTGCAAAAAAAA
AAAAAAAAAAAATGAACCACACTTCTCAGCGTTAAGGGCGAGCATCATATGCAAATATCATTTGCTCGAATTATGAAAAACCTACAAATACGACATGGGG
CTGCGACGCTGATAGTGGCGCCACGTTTTCATCATTCAATGCATCACACTCACGAGCAGAGATGAGTGCATTGGCCTCGGTGTCCATTGCAAATAATGTG
CTTCTGAAACGACAATTAGTATTGTCAATTTATAGTTTGGAGTTTCTACGCCGCCTTTTCAAGACCAGCGATCAAGATGGTGCTGCATGAGGAGGACTCG
GATGATCTGCTCCCTCGTATCTTTCGACGTTGTCATGGAGCCACAGGTCCGTCAAAGCGTCACTCTCAATCTACAAAAGAGCGACGATACAGCAACGGGC
TCCAGACGCTGGCTGTGACCAATTTGCACGAGTTGAGTCGAGAATTAGTCGCTACAGAGCAAGCTCTACACCCCAATAAACCAGAATTTATCAAGTCACC
ACGTCTGAATAACCAACCGATGCTGTGTCCGGCATTAGGCGAGCTCGAGGAGACTTTTCGAGAACTTCATGATCTTTACGAACGAAGTGGCAAATATCTG
CTTACGTTACGGGAAAAAGAGTACGAGGCTTTACTCACTCAAGTTGCAGTGAGAACTCTGGCTCAAGCCTGTTTAACTACTGAAAATGGAGATCTCGACG
CATCAGGAGTGAGAGTCAAGCTACTCGAGGTGGCAGTACGCTCCTTACCTCCATGGCGACGTCTGGCGCTCACCTTGTTCCTGAATACAAGTCTAACCTC
TCTTACAGCACTTCTCTCAACACAAGAAGACCCATCAACCATCCGAGCGCAACATTTGGAGATGAATTTGTTCAAACTACTTCGAGAAATGTTGGCCAAG
GCCGTGGTGGTTTCGTCATCTCTAACTTCCGAGTCTAGTGTCAATTTTCATCGTGGAAATGACTGGGTCGACCAAGCGGTTGGATGTTTGGACTTTTTCG
TTAAGAAACCGAATGGAAAATATTCCTCCGATCGCTTGAGGTCACTTGATGAGCACACCCTTCTGTTTCTCGTAGCTGAAGCGAGCAACCGTGACCTTGT
TAACTCCAATCTTCAACTGAAGGCGATGGAACTGGTTGTAGCGACGATGTACGCGCTCAAAGTCACTGGTAGATCGGACAATAAAGATCACACGGTGTGG
AACTGTGGATTGCCAGTTGCAGCAGTCGAGCAGTACATTAGTCTGGAGTTACTACTCTACCACTTTTACACCTCTCCCGTCGCTCGATTACAGCGCTTAT
CATGTATGGTGCTCGTGGATTTAGTCTGTGAGCAGGTTCGATGCACCGGAAGTCGTGAAGGCATCAGCAACGCGGGGCTTGATCAAATTTGGAGGGCATT
TGTAGAATGGGAGGATCCGGCGGTGGGTATGAGGCAGACTCTGTTATCGCCGTACGTTTCGAGCTCCCGGGTAGCCAAACAATTGGTACCGAGTTGTCCG
TTAGTACAGGAGAAACAGTTAAACGCATTCGTTAACCAGTTTCGATTGTTAACACAAGTTGACGCGTACTTTGGAGTGAATCCGAATCTCGATAAAGCCG
TTAAGGCGGTTAAGAGCCAAAGCAGCGCAAGTATTTCTGAAGGGCTGCTCGATCAAGTTTTGAAGCTTCTGCTGTCGAACCGAGCAGTGGAGCGCTTTCG
AGGCGAGCGGTGGCTTGCAGAATTGCTGACTTATGGTCAGGACGACGACGGGTTCTCTTCGTATGATAGTAAAGCGACGACTGAAGGATCAGTTCATAAG
CAGCATGAAGTAGTTTTGGTTCGTCCGAGGCCTGCCGACAATCCGGCTGGAGAGGAACTTGAAGACACATTTTGTTACGACGAAGGAGGAGAGATTAGTG
TGGCTGCCCAAGCGAAGTTCTGGGAGTTGGCTGCTCCGACAAACGCGATAGGACTCCGTGTATCGTTTACGAGGGTGTTGGGGTTGTTTATACGACGGAA
ACTACAGCACAGTGTGAGTATATAGTTTAATTTTAATGAGCTAGGAGCAAAACTGGTGGTTAACGAATTGTATAAATGCAGGCAGGGAAGCCAGGCGCGT
CGACTACTGAAGAGATCAACACTTGTCTGAGTGTTCTTCTTGATCACAAAGAGAGTGAGCCTGCGGTGCTGGTTCCAGTGATGCTGTTGATCCTGGACAT
TTGTCAGTGTGAGCTGTCCTACATTGATAAACGATGGAAGCAGCGTGACTCCACACTCTCCTCTAATAACCAAAAAGAAGCAATACTTGACCGCGTTGCT
TGGTCGGACTCGGTGGCGTCTCGAGTGCTGAATGGAGACGTAGCACTGGACAAGACGCTTCTTAGGCAGTTGGACGCTGAATTTTTCCTACATGTGTTGA
CGGTACTGCATGGAAGATCCGACACACACCAAGGGTTTGAATGTCGTCGTATCTGCTGTGGAGTGAACGATTCATTGGTCGGAGACGTTGCAGCGTGTAC
AGCATTGGTTGTCTCCAACATTCTTGCGGACAACGACGTTGCTGTCGACAAAGTGGGAGGTTTGGCAGTCTTGGCGCCGTTTTTGCAGTCGTGTGATACT
CGCATCGCAGTGTAAGTACGACGTTGAACGGGAGGGGAAGGAGCGCTGAAGTATTCTTGTTTGTTGCAGGTTCATGGCCAAACTCATCGGTGAGTTAGTG
AAGCAAAGCGACGAAACTCAATACAGCGCGTTCCTCCGCGAGCTGTACGTCGCCTGCGTCGAAGCCGACGATGAAAGCGCGCTGTACAACTCGTACCTAC
ACACACAGACGCTGCTCCACAATGTTGAAGTTGGTATGTAGCCATCTCTCTAAGATCCCCTTTCAAACTCGATATCATGCAAACTAGAGGGGACTGCAAA
CTGAAGTGTTTCGTTCGTATCATCATACAAAAGTGCCTGTATAAAACAGAATAGAATGACTGGCCAGGAGCGGCTCGCATGCCCCCACATCAGTTGCAAT
TGTTCTCCAGTAGGGAGAAAGTCAAAGAGTCTGGTTTAATGTATGTGGTTGCCGACGGGAACTTGATGTTGTACCCCTGTTCATTCGTTGAACGAATTGG
GTTCTCCGAAAACTCGGAGGATCGTGTGTCGAGTTCTGCCGTGGATTGTTGACCTTCGTGCCTGGGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCTTCGTGCCTGGGTGGGCCAGGGAGTTGCTGAAAAGCGGCAC
CTTGTGTGTAGATCCTGGGCGTGAGGCTAGCACCTCGGCTCTTATCGGCATACAATGAACCCCTGGAGATATTGTGTGGAGTTCTTGCTGCAATTTGCTT
GGACCATGAAACGCTCCAGACATTCTTGAGTCGAATGTGCGAGAATGATTGGATAGTCGGTAGTTAGTACAGTAGTTGCACTCGAAATCTATTAGATATG
GTGCAAATTGGGTGCAGAGTACACCCGAAAAAGATTCCCACATGATGGTGGTGTTACGTCTCGGGACGTTGGCAGACAGCGAATCCCTGGAGATATAGGT
GGAGCTCCTGCAGCAATTTTGCTTGGACCATGAAACGCTGCAGACATTCTTGAAGTCTACAGAAGAGTAGATTGTTATTTGTTGCCGAAATGCACTCGAA
ATCTGTAGTGCTGTCGTCCTGCGGACCGGATGGCACAATTTAATGGGATGGAGAGTTCTCTCGAGGAAGCTTCTCCACGTGACGTGGTTTCCGTCCGCGA
CGGACCCTCACAGAGAGGGAATTCGGTGAGCCACCAGGTGGCTGCGCCTTAAGGTTAACCAGCACGAGAGAAGCGCCTTGGGGGCGCCGGCAGATAATAA
ATTCCTGGAGATACGAAAGTACGTAAAAGTGGAGTTCACAAGCAACGCTTGAACCATGACACGTTCCAGACATTCCTCAATCAAATGTACGAGTACATGT
AGTTCTGTAGGTAGGTACTTTTCGCCGACATGCACTCGAAATCTGTTGTGCTTTCTTTCTTTGGGAAGGAAAAGCATATTTCAATGGGGTGGAGAGTGCT
CTCGAGGATAAGGTGTGGTCCAAACAACTTGACTCACTTTTAATGAACAGGTCCAGATCAAGAGGGGAGCACCTCGAGACGTCGGCAAAAACTAAGTACC
TGGAGATTTTGTTAATAAAGTTTATGCAGCAATTTGCTTGGGCAACGAAAATCTCCAGACACAACAATTCACTCTAGTTAAAGCCGAAGACAATAAAACA
TGTTCAGTTCAAAGCTACGAAGAACACGACACTCTAGCAAACCTGGGGGTGGAACTTGTTCTTTTTTACGAGATCTGGTTGAACGGGTCTGGGTTGTTAG
CTCCATTCATGGTCTGCGAAGTCTGTTGCGTTCCTGACGGGTGCGTCATAGTCGCGTTGGCTTGAGCAAATTGCTGTTGCTGCATACGCTGCATGTTCAT
CATCTGAGGCTGCGACATCATGGCCATTTGAGGCTGCATCATCATCTGCGGGTGATTCATTGCCATCTGCATGTTCGGGTACATTTGCTGCTGCATGTTG
CCGTCTGTGAGCTGGAGCTGGTTCATGTTCATACTCAGCTGCATCATATTCGGTTGCTGCATCTGCTGACTTTGCATCGGCATCGCCATCACAGGTGTCG
GCTGGTCGGCACCTCGAGCTTTTTGCATGTCGTTCAACGTCCGCTTCTCCTCCGGATTGGCAGACAGCGTCTTCTTCTTCTCACTCGCTAACGAGTTGAA
GTCCACGATGTTATTCTCTGGCAGGAGGCTCGTTCGGAACGCTTCGGTTTGCTGAGGCTGCGCTTCAGTTGGAGTCGAAGCAGCCGTGTTGGTATCAAAC
ACTGACGGCTGCGGAGCAGATGCCTGTACGGGAGCTGCGAAGCTCAAACCAGCGAGATCTTGCAGAGGATTCTGTGGCGTGTCGAAGATCGAAGGCTGCA
CTTCCTGCGTAGCAGTGGCAGGCTGGGCCACTGGCTCAGCATCCAGATCCACTCCCAGTAAGTCTACTGTTGCTGTTGCTGTTGCTGCTGCTTTCTTGCT
GCCACGTTTCTTCGCCTTTGCACGAGTGTTTTCCTTCTCCGAAACGGATTCCTCGTCGGTGGATGCAACAGATTGGCGGCGTGTACGCGACTTTTTCCCA
GTTTTCTCCTTCTTGCTCTTGGATTTCTTGGGTTTCTTGGACTCCTTCGATTCCTCTACGGGTGGAGGCGGCAGCTTGGCTGGGTCGAACGAGAACGAGT
AATCCGCTGAAGCTTTACGCTTGCCGACGTCTTCGTCGCTGTCACTCGAATAAAATCCGCCGTGCTTTTTGGTCTTGGATTTTTTCTTACTCTTGCTCTT
GTGGCGTCGTTCGTCCGCTGATTCGGTCTCCGAGGACTCGGAAATGGACAATTCCTCGCTTTCGCTCTCCGACGGACTTTCACTCTCGCTCTGCTGCTTC
TTTTTGCTCTTTTTGCTGTGTTTTTTGCTCTTCTTACTGTCACTTTTCTTCTTGGCGTGGCGATGCTTGTGGTGGTCCGTGGAGCTCAAGCTCTTGGGTT
CATAAGCATTTGGTGGATTACTCGAGTGCCCCCTGTTGTAGTCCGAGTACGCCTTCGGTCTCTCCGTGGCAAAGTCGTTCTGGTAACCCCCTCCGTATCC
CCCAGTGCCCCCTCCCGAGTAGGAAGACGAGGAACTGCGGATATCTGCCATCCAATTGGCACGACCATCATTTCGAGGCATCTGATGCGCGTAGTGGTCC
GGGATGGAGTCCGTATTGGGCCCGCGCGCGAGTTTCCCGCCGTATTCGATGACTTTACCGCCGAGCCATTGGCCGCTCTCGAGGATCTTGCTCTTCCAGT
CGCCAGCGCCCGAGTCGTGCGACGCCCCGCCACTGTACGAGCTCTGCCCATACTGCGAGCCGAAGCGGTTGCGGTCGTGGAAGTTGCCGCCCGCCACTGA
GTTCTGCATCCACATGGCGACGTACAGGGATTGACACAGTGAGGTCTTGGTGATGAGTGTGGAAATGATCCTTCCAGATTTTTTGTGGATGAAAAGCATC
TGATTATATACCGAAAAGGTTTTGGCCAATGAGAAGGATAGAGTGTTTTAAATGACCAATGAAAACTCAGAATTTAAAGTATTGTTTCTTGCTCAAAATT
CTGAGCGGGAAGGTTCAGTTGACAATTTTGCAATAATGGACGCTGGTGAGCGCTGGATGGAGGGCGAGGACGTGGCGGAAGAGGAGTTGCGCCTGCTGGA
GGCCATGGCTAACGTGTCCACTGCAATGCAACAGGTGAGGATGCCAAGCAGTTGCATCACACGCTGTCTGCAGAGTAAAAAAGAACGGGTCATTGACACA
TTCCTACGTTGTCAGTTCAATCAGGTGCTGGCCAAGCTCAATCGACAGACCGTGGAGCTGTCCAAGGAGTTGGGAACGGCGGAGCGGCAGTTGGTGCGTC
AACCTTTGAAGATGAACGCTGCTAAAGAAGGATTGAGGTCTAATTTACCAATATTTTATGTGTCATTTGCCATTCAGAACGCGCTGTACCTGCCCTTCCA
AGCCGCTATTTATGAGATGCAGAGCTCCACCAACCGAAGACGAACAACGCTGTCAGTACCGACAGTGACGTCAGTGGCAACACCCGAGGCGCAACGGACA
GAGCTTTGAGCCTCGTCACATTCCTGTAGCTTTGTGCCATTCCATAGAGCGATCAAGTGTTTTTATTTTTCTGTTCTTACACAACTCCTGCGCATACGGA
AGCAAACCCGTCCTCTGGCTGCTGTGGTACGAGCGCTTAGCAGTTTACTTGGGGCCAATCATGTCCTCGGGGCGCACGAAGCGGTCGAACTCCTCGCCAG
TGAGGTATCCGAGCTTGATGACAGTCTCACGCAGAGTGGCGCCGTCCTGGTGCGCCGTCTTGGCCACCTTGGAGGCCTTGTCGTATCCGATGTGCGGGTT
GAGCGCCGTCACCAGCATCAGCGAGTTCTTCATGAGCTGGTCGATCTTCTCGCGGTTGGCCTCAATGCCCACGATGCAGTTGTCCGTGAAGGCGTTGCAG
CTGTCTCCGATCAAGCGGATCGAGGACAAGAGGTTGCTGATCATCACGGGCTTGAACACGTTGAGCTCGAAGTGGCCGTTGGAGCCGCCCACCGTCACAG
CCACGTGGTTGCCCATGACCTGAGCGCAGACCATCGTGATAGCCTCACACTGCGTCGGGTTCACCTTGCCAGGCATAATAGACGAGCCAGGCTCGTTGGC
AGGCAGTGTGAGCTCGCCTAGACCACTACGCGGGCCCGAACCGAGGAAACGGATGTCGTTAGCGATTTTCATGAGCGAGCAGGCGATGGTGTTCATGGCA
CCACTGGCCTCCACGACAGCGTCGTGGGCAGCCAGAGCCTCGAACTTGTTAGGAGCCGTGATGAACGGTAGTTTGGTCTCGTCGGCGATGATCTTGGCGA
TCTCAGCGTCGTAGCCCTTGGACGTGTTGAGTCCCGTGCCCACAGCGGTACCGCCCAGTGCGAGCTTGCACAGGTTGGGCAGGACGCGCTCCACGCGCTC
AATAGAGAGCGCGATCTGCTCACGGTAGCCGGAGAATTCCTGGCCCAGAGTGAGAGGCGTGGCGTCCTGCGTGTGGGTGCGTCCGATCTTGATAATGTCG
TCGAACTCCTTGACCTTGGCGTCCAGAGCGTCGTGCAGCTTGTGAAGACCAGGAAGCAGCACACGGTGGATTTCCTGCACTGCGGCGATGTGCATGGCCG
TAGGGAACGAGTCGTTGGACGACTGGCCCATGTTAACGTGGTCGTTCGGGTGCACGGGCGTCTTGCTACCCAGAACGCCGCCTGCCAGCTCAATGGCGCG
GTTACTGATGACCTCGTTCGTGTTCATGTTGGACTGAGTACCCGAGCCAGTCTGGAAGACCACGAGGGGGAAGTGGTCGTCCAGCTTGCCGGCAATGACG
TCGTCGGCCGCGGCGATGATCTTATCGGCCACAGCGGCGTCCAGCTTGCCCTGCTGAAGGTTGTACTTGGCTGCGCACTTCTTAACGACGCCAAAGGCCT
TAATCACAGGCATGGGCATGCGCTCGCGGGCGCCACCGATGGGGAAGTTCTCGAGACTGCGCTGCGTCTGCGCGCCCCAGTACTTGGAGTCGTCCACCTT
GACCTCTCCGATCGAGTCCGTCTCGACACGGAAGGAGCTGGCGGCGCGCACGGCCTTGACCGTCATGCGGGAGGAGCGAGTTACAGCGGCGGAGAGCATG
TCGCCCGAGGAATTGGAGCTGTGGGTGTCCGACGTGATTGGAGACTGAGGGGGGGGGGGCAACGAATGCTGGCCCCAGCTTTTGCGTGCGTACGTGGCTC
GGCTTTGAGCTCTTTGAAGGTTGCTTTGCATTGTGGCATAAACGCAAGTTTCGAGAGGTTTTTCAATTGGTCCATCGGAAAAGATCGTGGCCAGGGAAGG
GACGCTAAAAGATATCCAAGGTTTTATTGTATGGACATGAGAAAGGTATAGATAGAGATAGTTGTTTTGAGGCGACGATTAGAGCGAGTATTAGTTCTCG
AAGGTTGTTAAAAGCGGCAAAGCGATCTTTTCGTGCGCTAAATCTGTGGCTCGCACGAGTTGAAGTTGTCGGACGCGTGCCATCGGCTAATCGGCCCCGC
AAAAGCCTTTGTCGAGCTGAAAGCTCGAGCCACGCTGCTGTTACTTCCCAAGCTGATAGAGCTACGTGACACAGCGTCATGAAGGCCATTTTGGCAGCCG
TTGCATCTTGTACATGTCGAGTATCGTTAAATGTATTACTTGTATGAGCAGAACAGTTTTATTCATCTTGACGTATGGCGTGCAAGGTTATCGACCAGCG
TTCTTGCTAGTTGGTGCACGATAGCCCGTTGTCGACACCACTTTTCATGTATCTCCGCTTGCTCTTTTCGCTGTTGCCTCTCTCGCTCGAAGTCTTCGCC
ATGAACCGCACGCAGACGAGTATTGAGACTAGCAATGCGCTCGCTCGTACTCGTATGACGGTGTGTCGTTGTCAGTTCCAACTGAACAAGCGTTTGATTT
TGCTCTACTGCATTGATAATATGATCCAGCGTGCACTGCTCACAACTAGGAAAGCGACCCAAGAGCAGCATACGAAGCTGTGGATGAGAGGAAACGGCAG
GGAGCAGCGGTGATAAACCACTGAGAGTAAAATCATTGCCGGACTAACACAGGATCAACGTTAGCGTGAAGCCATCTCTAGTTACAGGCAAAAAGACGTA
CCAGATCTAGCCGATACAGACGCACGCAGCGCTGCATCATCTGTACCAAAACGTAAGCACTGCGGTCACCAAAGCTGTTGCGTTGCAGGTCAAGAGCTTC
GATACGTCCACTCCAAGCGATACCAGAGACCAAGACGCCAACCATAAGATCGTCCAGTCCACAATTTGCAAGCGAAAGTGATGTTAGTAGAGCGTAATTT
GCAAATGTGTAATGAAGCGAACTGCCTGTGCGTGGAGCGATGACCTCCAACCCATTTCCAGGGGTCAACTGCGTTGGGTTGGCAATCGTGACGGCTCTAA
GCGTTGTTGTCGGTACTCGAAGCAGTTCACTCAGTTCACGAAATCCACCGTCGCCGATGTTGTTGTCCACGAGTGACAACGTACGTACACTCCGATTAGT
GCGAAGTGCACGTAGTATACGTCGTGTACCCTCTTCGGGCAAAGCGTTATCTTCTAGTCTTAGTTCCATGACCGAATGGTTACCCCGCAGTGCAGCACCA
AGAGAATCCGCCTCGGCAATTGTCAATACAATGTGCTGGAAATGACACACCACCAGCTCCAGCGACGACAGTTCAATCTTTTTGATAGATTCAAAAAGAG
TTTCTCTCTCGATCGCAGCCATATTCTTATGCAAGTAGAATTCCATCCTCGTCCGATACACTTCAGCTTCCGGCTCGTCATCGTCCTGGTTGCCCGCCAC
CTGAACGGTAGTGACTGAAGCCGGACATGAATTTTTCATGGCATCGGCTAAAATTTGTAATCCGTGAGTTGATAGATCATTACCACGCAGATCGAAGAGC
ATGTTTCGTGTATTAGCAGCTTGTAGCATTGCACCGAGAGCTTCAGCTCCATCGTCGTCGATCTGGTTGTGTGCTAGACTGAGGTGACGTAGTGTCGTGT
TGGTACCGGATCGGAAGAAGACGACCCATTCTTTCAACGCCTCGCTCGTCAATCCACAGTCATCCAATACCAGACTCTTGACGGTACTGTTCTTCATCAA
CGACGTGGCTAGACAACCTGCTCCATGCTCACCCAGTCGATTCCCTGTCAGATCTACGTGCGTGAGGGTCGCATTGGTCTCCAAAAAGTCCGCAAGTTGC
ACCGCCAGACTGGGGTTTAGTCCAGACCGATGTAAATGTAACTCAGTCCCTTTCGCGCCTTCTTTTACGTGCTGCAAGACATCTGCTAGCGATATCGAGT
CTAGCTTAACGGTATCCTGTACCATGATCTTTGCTTGTGTCGTTTCGGGATCTGTTCCGGAATGACTGGTGTATTGGATACTGAAAATTAGTGTTCACTT
ATTACAGAACTTGATAAAAGATCCACCGTGTCAAAAAGCTCTAGATACCATGAGCTCCAGATCAACCCGCCACTACCTCGCTATACTGCTTCTCTTAAGC
TTTACGTTGCTTAATACTGTAATCTCATGGAGTATTGACGATCTTTGGCAAACCGCTGACCAGTTATGGCAGTCCGATGACTTGGACTCGGTTATGGAAA
TATTGCAGCATATCGAGAGGCAACAGCCTGGAGATCGACAAGCTCTCGTTGGCATTGCATCAGTTTACGAGCGACGAAGAGAATTCGACAAAGCGCTGGA
AGTTTTGAGCGCTCTATTAGCCACAGAACCACGAAATGTTATATTGTTGCAGCGGATTGGCGAAGTTTACACGGGCAAACGGGAAATACCAAAGGCGCTG
AAATTTTTGCACGCTGCAGAACGAGAGGTAGACCCATTGGATAATGCGCAAGTGGATTCCTTAATGCGTGGATTGGCGTTGGCGTATCATCATGGGGGAG
ATTTTACGATGGCGGAGAGCTTGTTCAAACGCGTGGGCGAGAGTGGGCGTTCTGCGGCTTTTTACTTCGACTATGGAGTCACTCTGGATAATTTAGGCAA
GGCGCGTATGTCGCTGATAGAGCTGCTGGAGATTTATTCGGTAGAGGACTAACTAGATTTTTTGTGTTGGACGTAGATTTTAGATGCTGCAGACGCCTAC
AATGAGGCTCTGGCGATCGAACCCACTCACGGTGAAGCGAGGATTAACATTGCTGCCCTCCACCATCAACACGGCGATGTGAATGAGTCGATTCCACACT
ATCTGGTGCGATTTTTATTGATATAGCGATGTTCTAGATCTGAACAGCTAACTTTCTTTTTGCAGGATGTGATAAATTCTCCTTCAGCTTCTGTAAAGCT
GAAAATTATGGCAATGGGCAATGTTGGTGTGGCGTATGAACTTACGAAAGATATTGTGAGCGCTTTGAGCTGGTACGAGCGCGCTTTAGAAGAAATCACC
GCTTCTCCTGATACAATTTACCCGAATGGGTTATCAGCACAGATGGCACGGATGCATCTCATGGTACATGTGGTCCGAGCCAAGCTTAGTGCCTGCGTGT
GGGCAAATGCAGAAGACGAATTTGATTATCTATGGACGATGGTAACCAGCCTGCAGTTAACGTCTGATGCACGATTGGTTTTCACACCGTTTGATTCGTT
ACTGCATGACATGTCACCACAAGACAGAAAGTTATTAGCTGTACATTTTTCTACAGCGTTCAATTCTGGT