Description :
From Genome Similarity Track
Location :
Scaffold_521:17389- 19267
Transcript NameFunction/comments
g14391.t1hypothetical protein

Sequence
1878 bases(100 bases per row)
GAAGGAACGCTTCGACGAGCAAGGCTGGGACTCGCTCAAGGCGAGCCCCTTTTACAAGGTCTTGCGTGAGTACAAGAATGTACTCCCGGACGACATTCCT
GCGGAGTTACCGCAGGACAAGGGTGTTCAGCACGAGATTGATCTCGTGCCGGAAACGAAGTACTGCGTCACGCAACAGTGGCCACTGCCGCGTGAGCAAG
CCAAGGCAATCGACGACTTCTTTGAAAGTCGTCGCAAGGCAGGACAAGTGCGGGAATCGAAGTCCCCGCACAGCGCGCCTACGTTCTGTGTCAAGAAGCC
ACAGGGCGGGTGGCGCATCGTTCATGCGTACAACAAGCTGAACGATGCGACGGTACCGGCGCAGACGCCGATACCTCGAAAAGATGTTATCATCGATTCG
ATGACCTCGAGTACTATCTTCAGTACTCTTGATCTGAGAGACGGGTTCTATCAGATCCTCATGCGTGAGAGTGATATCCCTCTCACGGCGGTAAGCACTC
CGAGCGGCATGCTCTGGGAGTGGCTCGTGATGCCGCAGGGGCTGAAGAACGCCCCAGCGACGTTCAACAGGTGCGTCACGCACTTGTTGCGCTCGGTGCG
CGACTTCGCACCGAGCTATTTCGACGACGTGTTCATTCACAGCCGGGCTGTGAATGGGAAATCGGATGTGGAGATGCATACAGAGCATCTCCGCAAGTTG
CTTGAGCTTATGCGAAAGCACAAGCTCTATGTGAACCTGAAGAAGTGTATCTTTGGGGCGACCGAGATACCCGTACTTCGGTGTCTCGTGGGGAAGAACG
GCGTACTCCCTGGCCCAGGAAAGGTCAGAGTGATCAATGAATGGCCTACGCCTTCAAATGTAAAGGAACTGTGGCAGTTCATCGGACTTGCCACGTACTT
GTGCAAGTACGTGAGCAACTACGCGGGCAAGATTCGCCCGCTGTCGCAGCTCTTGAAGAAAGAAGCTGCATGCGAATGGACTGCTGATTGTCAGCAGGCC
TTTAAAGCAGTCAATCAGGGCTTGGCTGAGGCGCCGATCTTGGCGGTGGCCGACCAAAATCGTCCATTCCACGTTGTGTGTGATGCATCCGATTTCACGA
TCGGATGCGCACTGATGCAGCACGATCACGAAGGTCGCGATCGTGTGGTTTACTACCAATCGCGTCAGCTGAAGCCAACTGAGCGCAATTACCCGGTACA
TGACAAGGAACTCCTTGCCATGAAGTATGCACTCGCAAAGTTTCGAGTGTATCTACTTGGGAGTAGACCATTCGTGGTCTACACCGACCACGCATCGTTG
CGTACGGCGATCAAGTCGCCGCACATATCACAAAGAATGGCACGGTGGCTGTCATTCTTTGCTGAATACAACTTCCAGGTTGAGTACAAACCTGGAAGAT
TGAATGTCGTGGCCGACGCGCTTTCGCGTAGACCAGATTATGCGGTGCAAGAGGCCGACGCCAACGCAGTTGGCGTCGTCAGGACGAAAATCCCCTCGCC
GTCCTTGCTGGACGAAGTGAAGGCCGCATACGCACATGATGCGGATGCGAAGCAATTGTTGGAGTACTTCTCCACACCTTCTGACAAGTCTCGTCAGAAG
CTGGCCAAACACCTTCATGCCCGTGTACACCGTTATCGTGTACACAATGGTCTGCTGCTTTACAGCGCAGTTGACGACAACGCAGATCGCATTGTCGTGC
CGGATGATCATGAGCTGAAGCTCAAGATCACGTACGAGTACCACGATGCCCCGACATCGGGACATCCTGGCCGTGAGAAGACATATTTGCTTCTCACGCG
TGACTTCTACTGAAGTCACCAGTACAAATGGGTACGCAAGTACGGTCGTGCTTGCGAGGTATGCCAGCGCGTGAAGCC