Description :
From Genome Similarity Track
Location :
Scaffold_51:173882- 177329
Sequence
3447 bases(100 bases per row)
CACATCCTGATTGCTAGTGGTAACGCACTGCCGCCGCCAGCCTACGGTGCGGTATGCGATATCGACACACAGGGGCACGCCCCAATTAAACAGCGTGCCC
GACGCGTGCCGCTGCGATTTCTCGGCAAGCTGTACGAGCTGCTGCGCGCTTTATTGCGTGCAGGACTGATCGTCTTTTCAGACAGTCCATGGGCATCGCC
GATCGTGATTGTGATGAAAAAGAACGGGCTGGACATCCGGCTCTGCATTGATTACAAGATGGTGAATGCTATCACCGCGATCATGGAGTACGCAATGCCG
CTAGTCGACGACCTGTTAACAGATCTCGAGCGCTACCTATGGTTCTGCTCGCTGGATGCAGCAAGCGGCTTCTGGGCGGTCATGATGAGCGTAAAGTATC
GGCGTTCGTCTGCGCACTCGGACATTTCGAGTGGTTACGCATGCCCTTCGGGCTAAAGAACGCGCCGATGATCTATCAGCGTATGATTGACAACGCACTC
TGGGGGTTCGTTCAGCCTAAAGGAGGTTGGTTTGAATACTCGGAGAGGATGCGTTTAGCTGAAGAACAGGCCAAGGAACGTCGTGGGTCAAGCGCCGAGG
GTTCGTTTCAAACGAAGTTCGCGGCAGACCGCGAAGCACCGGTAGAGACCGACCCTGTACTACAACTCGTCAACAGCCCCGTCGCTGACATGTTTACGAA
CGGGGAACCGGACGAATCATCGCTGGTACCTGTATTTGGTCGACAGTCGTTTGTGGATGATATTTGCTTCGGTGGCGAGGATTTCGACAGCTGCCTGGCG
ACGCTGGACCGATTGCTGTCGAGGTTTGCACAGTGTCGGATCAGCATTAGCTTCACCAAGAGCATCTTCTGCCAGCCCAAGGTGGACTTTCTGTCGCATA
AAATTTCGCCAGAAGGTATCAGAGCTGACCCCAAGAAGCTTGCGGCCATCACCGAGCTTTCGTTTCCAACGAGTAAGAAGGGCATGCAGTCGTTTCTTAG
AGCGATTAATTACTACAGTCGCTTCATTCAAGACTTCGCGGTCTACGGTGCAGCGCTGTACCAGCTCAAGGATGAAGACTTTGCCGTTGAAGGCGGCCTT
TCTGTGGCACGTCGTTCCTTCGAAAAATTGAAGACGAGTGTTTCACATTCACCCATCCTCAGGCACTTCGATCGGTCGAAAGAAGTTCACGTCATGCTCT
TTGCGAATGAATGGGCGTTGAGCACTACGCTAATGCAAGAACATGAAGGCAAGTTACACCCCGTACGGTTCCTCGGTCGGGTGCTTAAGGAAGCCGAGAT
GAACTACCATCCTGCTGAGAAGGAAGTTTTGGCGTTACTTCTGCTGTTGAAGATCTGTTACGTCCAGCTGGCAGGAAAGACGCTACATGTCTATACACGA
TTCTCGACGTTAAAGTGGGTGCATAAGTCGAAGTCTCTCTTCGGACGCGCGGTCCAGTTCGCAGTGCTGCTATCGCAGTGGCACCTGAAGGTGCAGCGCG
TGAAGGAGAAGGATGTCGCCTTCGCACAGCTCCTCCAGTCAAGCATCACGAGCTTCGTCGACCTGGAAGACTCGCTCGCGCTGGTGGCACCTCCACACAA
GGGTTCCCCGACTATTCGAATGGACCCCGCGTTGCTGTACGCCAAGCTTTCCCGTAATTACAGCGGATTCGTCATGTCTTTTGACGGGTCAGCGAAGACA
GAGAAGTACGGTGGCTACGGGAGTTGTTCATGGGTGCTGTGAAGCCTTCCTGAGTGGAAGGTAGTGATTGCTGCAAACGCTTACCTCTCGGCTACCACGG
TGAATGAGGCAGAGTATACAGGTATGATAAACGGTGTCAAGGCTGCTATTGCGCACGGTGCCGAGGATTTAGTCATCGTTGGTGACTCAAGGCTCGCGAT
TCAACAGTCACTAGGGGTGATCGCATGCAGGAAGGAAACTTTGCTAGCGCTGCTGAATACTCACAAGGAGCTCACGGCCAAGCTTCGATCAGTTAAATAT
CTTCACGTTGTACGAGAATACAACGCTGCCGCAGATTCGTTAGCCACTGAAGCGCTGGAATCGAAGGTCAGTCGGGTAATCTTGGCTGAAACTCTCAAGT
CGGAATTGGCATCGCTGAATCGCATCCAGGAAATGATCTACGAACCGGATGAAGACTCGGTAGATGTCTCGTCACGTGGAGCAGAGCGTCAAGTACATGT
ACTGTCAGGCAACGAATCTTCAAAGTGGAAAACTTTCGAAAATTTCGTGGTTGATTACAGCTCACCAAAGTGCGATTATGGTAATATGGCAGTGATGACT
CGGCGACAGACGAAAGCCAAGAAGCGCGTCACGTTTGCAGATGAACACTCGGAGGATGTCTCAAAAGCTCAAGAACAGCATGAAGAACGGCGAGAGACGT
CCACCGAAGATCCATTCGGCGAAGATTTGCCAGACCATCCTCACAAGACTGTACCAGCGGCATTTCCCGATGCGGAAGATGTTGACCCGGTAGCGATACA
GCGGGAACGACGCAGACGGATACAGGTGGCACAAGACGAGGAGCAGAAGTGGTTTAACATCAAGAAGGTGCTTTAGGGCCAAGCACAAGAGCTGAGTTAC
AAAGAAGCTCGAGATGCCTGGAAATACGCTGACCGGTTCGTGTTATCAGAAGACGGCGTGCTTCACTATCTTGGATTGAATCGTCGGTACGACCACGGTT
GGCAAGAGGAGACCAAGCTGCGGCTTGTGGTACCGACAACGATGATTCAAGAGATCTTGCAGAACTGTCACGTCTCGCTGGAAGGAGGAAATCAAGGTGT
GGTGAGAACGTTCCATCGCGTTAAGTCCGATTATTATTGGATCGGCTTGTACGCTGACGTGGAAGCATGTGAAGTCATGTCCAGATTGCAGCTCGAGTAA
AAGCCGTCCGCAGCTTCGTGGATACTCACCTGGCAACGTACTAGCCGAACGACCTTTCCAGATCGTCTCGATGGATTTTGTGATCCCACTACCGAAATCT
CGCAGGGGCAACACGGCGTTGCTCCTATTTCAGTGCTCGTTTACGGGATTCGTTATTGCCAAGGCTATGTCAGATACGACTGCACTGAGTGTTGCCCAAG
TGTTCGAAGAATGTGTGTACCGACGATTCGGATCCCCATCATTAATAAGGCACGACCGCGACCCCCGCTTCATGAGCGAGGTTTTCCAAGCTTTCGCAGA
GATGATGCAGTCAAGATCACGAGCGACTTTGAGCTATCGGCCACAGGCTAATGGACAGCAGGAACGCTCGGTGAAGTCGGTGATGGGTTCCGTACGGGTG
TACGCGGAAGACCCTCTACAGCAAGATTGGGACGAAATCGCGGAGAAGCTAGTATTTGCTATTAATACTTCTCAAGACACTACGAGGAAGGAAACGCCGT
TCTACCTCGTTCACGGTTGGGATGCTCAGTCGACGTTGAGGGCAATG