Description :
From Genome Similarity Track
Location :
Scaffold_91:173874- 175706
Transcript NameFunction/comments
g15227.t1hypothetical protein
g15228.t1ETI47694.1 hypothetical protein F443_08141 [Phytophthora parasitica P1569

Sequence
1832 bases(100 bases per row)
AGAAAATCAGCACACGAGAGCCCTGGGCCTGGAGCTTCGGCAGGAGCTTGTGCAGCAGCGTCATTTTACCACAGTTTTCCCACAGGTGCGCGCCCTCCTG
GTACGGCGGACCAGGCTCAGCGCCCTCGAACAGGTACGGATGGTTGCACACCTTGCGCAACTGCATCAGAATGTTGAGCAAGCGGACGCGGTCGCTACCG
CCAATAGCGTTCAAGTGCGTGGCGTCGCGGTGGAGCACACGCATGTACCACTCGCGCTGCATCTCGGACAGTCCCACGTACAGCTTGGTCTCGATCTTCG
GCGGCAACGAGTGCTCGACGTCCGCCTTGAGCCGACGCAACAGGAACGGGCGCAGGATCGTGTGCAGTTTCTTGATGACATTCTCCTGTCCTTCCTCTTC
ATCCACATTGAACCACGAGTCGAAGTCCTCGGAGTCCGAGAACACATCCGGCAGCAAGAAGTTGAGCAGCGCCCAGAGTTCGTGCAGGTTGTTCTGCAGC
GGCGTGCCGGTGATGAGCAGTCGGTGCTCCACCTTGAACTCGCGCACGACCTTCGAGAGCTTGGAGTTCTCGTTCTTGACACGGTGGGCCTCGTCAATGA
GCAAGTACCTCCACTTGATCTTCTGCAGGAGAGCCTTCTCGATAATAGCCACCTCGTACGACAGCACAAGCGCGTCAAAGTCGCGCTTGACCACCGTTTC
TCTCTGCACGGCACGTTCTTCCTTGCTGCCCATGAACTTGAAAGCTTTAATGGACGGACACCACCTCTTGAGCTCCTTCATCCAATTGCCCACTGTACTC
TTTGGTACAATGATGATATGAGGTCCTTCAATGCCTCGGGCCTCTCTCAAATAGGCCAGCAGAGAAATGGATTGCAGGGTCTTACCCAGACCCATTTCAT
CGGCCAGAATGCCGTTCACGCCCGAGTCGTGGAGGCGGATCATCCAGTTGAGGCCTTCCAGCTGGTAGGGCTTCATGGTGCCAAACTTGATGATCGACGG
CTGCTGCGTCACGCGCGTGAAGCGCGCGTCGTCCATGTCCTGCAGAGCCTGTGCGTCGGCCTGTTTGCTGCCTTTGCCACGTCTGGAGCCGGCCTCCTTG
GCCGCCGCCTTTGTCCTGGACATCTCCTTGCCTACGGCGCTGCTGCCGCCCATGAGAAAGGACGTGAAGACGTCGGATTGGGCCATGAGGAAGTCCATTT
TCTTTTCTCTGGCGCTTTTGGCCCCATACTCGACGTCCTGTGCGAGGCTCTGGCGCACGAGGTCCAAGGACTTGCTCTGGCGGTCGCGCTGCTCCTGTAG
AACAGCCTCTTCCTCTTTGCGGAGAGCCTCTCGCTCCTCGGTGGACAGCAGCGTCTTCTTGGCGTCCTCGGGGACGCTGGCCTCGTTCATGTCGTCGTCG
TCCTCGTTGTCCTCCACAGACTCACCGCCGTCCATACTGGCGTCATCCTGGACGTCTTGGAGGACGGAAGGGGACGCAGGGGGAGATGCGCTGACGCTGC
TGCTCGGACTGGCGCTGGGACTGCCACTGCTGGGGCTCGCGCTGGACTCCGCCATGACTGGGACTGACTGACTGCGCGGTTGTATGGATCGGAACGTAAC
CACCGTTTGGCGCGAAGTTCGCATAGGTACGATGGGAGTGGCCCACGTAAGAATAAACGTGGTGTGGCCTCCCGTAATGAGCAGGTCGTTACACAATTCG
TACATGAACTGCACACAACGTTATTCCGTTTGGTGGAGGAGACGTCACTAGTGTATCAACAGACGTAGAGCTCGATAGGATGGCTGAGCACGACGAATAT
GAGCCGCAGGACGCGCGCCCGCAGCGACCAGA