Description :
From Genome Similarity Track
Location :
Scaffold_315:17384- 18939
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_315-snap-gene-0.14Conserved gene of unknown function
Pytar_ATCC12531maker-par_contig_315-snap-gene-0.15Gene of unknown function

Sequence
1555 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGCGTGGGCACGACGACTACCGCATACGCGAT
GATGGACCGCGCGGCGGCGATGCCGACAAAGCTGACAGATCGCACGGAGAACGACTCGGGCGTGCCCCACCGCAAAAGCCATGCGAACGTCATGCACAGC
GACAATGGCAATCACAGTCTAAGGAGGAGGAGCGTGCNNNNNNNNNNGGCATCCAGAACTCGGATGACGCCCCAACGCTCCGTCGATCGCAATGGCTGGC
CTTGGTCGAGAAATTCGTGCACACTGCCCAGACACTTCATCGCCACGGGCAAACGATAGGCAATCCAATCTTCTTGTCGGGATGGTCATACTCGACCAGC
CGAGACGAGGTTGCGAGCACCTCTAGCAAGTCGAATGACGACGCGAGCTGGGGCGTGAGTATGTGGACCGGGTCCTTCGGCACACACAGCTTCGAATGCA
CTTGACCCGACGCGGAGATATTCTTGCTTGACCGAGTCACACAACTCTGGATAGATGAACGCGAGAAGGCCTAGATTCTCCTCTCGCACTTCCACCTGCA
CAGCGTCCCCTCTGCTATTCTTCGTGTACGTCAGCTCCAGCAGCGTGTCGAATGCGGTACGGACGAAGGTCTCTTCCCAGACGAAGCACATGAATTCGCG
CCAGAGTTCCCACATCAAGAAACGCTCGGTCGGATCGGGATGGAGCGTCTGCTCAATGAGGAAGAGCTGTGGCGGTGCCGTCGTGGGCTTGCACGACGAG
CGAGTCGAGCACAATATCCACCGACAGATTTAGCGACTTTGAAAACCCTCCAAGCAGCACTCGGCTCCCCCATGCACGGAAACTTGTGAAGACCGTAGCC
ACACCAGTGAACTCGGTGGCGACGCTTGCTGGTGACGAGGACNNNNNNNNNNTGGTAATGATGGCGCATCGTTATCGCCACCATGGCCCGCATAAAATGC
AGCGAGCGCTTGTACGTGTCCCCACTCGAGTACAGCTTCACTGGCGCCCTCAGCAGCCTCATCCGCATCGACGTACTGGGACCGCATCTGCTGGACCAGC
GTGATCATTTTGTCGCGCAGATACCGCAACAGCGTCCCACCAAACGACCGCGTCGACTCCTGGAGCTTGTCGATTCGTGTCATCGTCTCTACAAAGGAGA
TCACGCATTGCAGTACACGGATCGCCTCGTGCTGGGTCTATTCGGACTCGGTCACGAGTGCATCTGCGATCGGGATCACAGCCGCGATAGCATCGACTGC
GAGTGNNNNNNNNNNGTCACCACCACGTGCACGGATCGCCTCATGCTGGATTTTCTCCGACTCGGTCACGAGTGCCTCTGCAATCGGAATCAGCGCCGAA
ATAGCATCGACTGCGAGCGCGACACTGCACTTCCTCTTCCGCAGAATCAGATGAA