Description :
From Genome Similarity Track
Location :
scaffold_587:17384- 18569
Transcript NameFunction/comments
g9380.t1hypothetical protein

Sequence
1185 bases(100 bases per row)
GATATATACACCTTTTCCCAGGCAAAATGGCACTTTTCTCAATCAAAGTGGTTTTTTAAAAAAAAAAATCGTAATTCGGATAATAAGGTTTTTCAGGCAA
AGTGGTTAGGTACGATTCCTTTCCCAACCAAAGTGGTCCGCCTTCCTACTGACCTAACGGCATGTCTTCACCCCGCTCCGCTAAAAAGATATTCTTCAAG
CAGTGTCGCTCCATGCGCCATACCAAACGCTGCGTTAGAACATGCTTACACTATTCGACAGCTTCCTTCAGTAGTGCCGTCCTGTGGGCCGTAAGAGAAT
CATACTCACCACGTACCAAAAACTCTCGTCGCTTCGTAGCCAGGTGTCCTTTCATGTGAGCCTTCAGCACACTAAAACAACCCTCGATTGCGTGGACCGT
ACGGCGCTAAACGAAGGATAACAAGCTTGTCGCTGTTGGCAATGCCATCAGCAACAAGCTTTTCCCGGGCAAGCGTCTCCACTTGGCTGTGTGCGGGTGC
ATTATCTGTGACAATAACCACCTTCTTGTCGACATAACTCTCCTTGTACTCGTCCGTGTTTAGCGCCTCCACAAACAGGTCTGCCACGAACCTCGCGTTC
TCGTCCATGTGGATGCTGCCGTCGTGGGTGCGCAGGAGCACCAACCCGCTGCCAGGCGACACGCCGCACTGTACGTGCAAGTTCTTCCTCTTGGACGGCG
GCATCTGGATAACCGCGCGCTCTCCTTTCTTGGCTCAGCCTTGGGTATGCGTCAAGTAGACATTGAAGTTCGTTTCATCGTGGTATATGACCATGTTCCT
TCCGCAGCGTGCATGTTCAGAGACTTAGCAAACTCCATGCGCTTAGCCTTGTTTACACTGCTGTTCATTGTAGATTTTTCGATGCGCAACGCCTTGACCG
TGTAGAGCATACCTTGGAGTGCTCGGTGAATTGACGGGTCGCTGACGTCGACGGCCATGTCACTTAGTAGCCGCTCTTTCATGTCCACCAGCCTCATGTC
CGCCTGCTCGTATAAGTACTCTTCCAACTTCGCCATCACGTCCACCGTCATCTTGACGCATGACGGACGGACGCCTCCTCGTGGCTGCTTCTCAATACTA
CCCTTCGCAATGGCGCGATGGGCAGTAGTGAGTGGCACTTTGTTGAAATAAGCAGTGTCCTTCCAGTCTTGACCGGCGAGAAAGG