Description :
From Genome Similarity Track
Location :
scaffold_10:1738350- 1739548
Transcript NameFunction/comments
Plaha_PHALS_11873protein phosphatase

Sequence
1198 bases(100 bases per row)
GTAAGCCACAATAACCGTCGTATCATCAATTACTTGCTCTTCTTTCATCCATCGACGATTTGCTTCCATAATCAACAAATCCACTGCAGTCTTTGGATCT
TTATGCTTCATGGCCATTTCAATACACTCTTCGTTTGACATAAATTCCCATAAACCATCAGTAGCTATGACCAAGCATCgatcattctcatcgagccaTC
GTGTCGTGAATTCAGGCTCAGAAATGACACCAGCCGTGTGAGCAACTGCATCCCCAAGCGAGCGTGACATGGCAAGGCCTGGCACGTCCATGTGTCCCAA
CCAAACACGAGGAGGTCCATCAATACCATCGTCATACTCAACTGCAAATACTCGACCACCTCTAGCAAGAATTCGAGTCTTTTCATCCGGTCGATCAGGT
TTATGGTCAACAGAAAGCTCTTGAAAGCCGATCTTTTCAGGACATGATGGACTATGCGCATGCATAAAGCCCCGAGCGATCCGTGAGTCTCCAACATTCC
CGACGACTACAAGATTCTCACGTATAACAGTCACAACTGCAGTCGTTCCACTAAATTCGGTATCAATACTTAGATCGGACAAAACTGCCTGTTCCACTAA
TTGCAATGTATCTGTAATAGCGGATTGTAACCTTTCAGCATCCTGCTCAATCTTTTCGGACCGTGCGAACTTTGGGTGCTGAAACAACTTTACTGGAAAT
TGATCCCGAATCGCACCCGAGACGCCGTCTCCAGCTTCTCCGTGACCGTCAAACACACACAAGAGCAAGGACTGTGTCTTTTGATCGTATTTAATCACCA
TTGCATCCTGGTTCTTTTTACGTGAATTATATGGTGCATATCCTCTCTTTGAAAACCCAGCGAACGCTACAGCCGCACACGTTCCGTCTGCTAATACTTG
AGCACTACTGGCTACGTCGTCAAGAGTGACTGCGGCCATTCCATCGACAAGTTTATTGTCACTTGCTACTGACAATCGACGACGTTGCAGTCCGAGCGAA
TGGTCGCCTCCTATCTGGGCTACAGGAAGCTTGCCAGGTGTCTTGATGGAGATTCCTTTCGGAGATGCTACGTTTGGGGCCGTAGCCTCTTGTTGCCGAA
CTTTAGTCAGCGAATTCATCTTGTGAGCCGGTCGGGAAGACATCGTTTATAAGGAGTAGCTAAAATTCCGGAGAGCCGGGCGActgcaaataggagaa