Description :
From Genome Similarity Track
Location :
scaffold_11:1738- 2946
Transcript NameFunction/comments
g12812.t1AF229252_1 reverse transcriptase
g12813.t1hypothetical protein

Sequence
1208 bases(100 bases per row)
GACATCCATCTGGTGCAGCTTGAGACCATACTTGGCAGCCAGACTCAGTACGATCCGGATGGACGTGAACTTGGCCACGGGTGCGAAGGTCTCGTCGTAG
TCGATGCCGTACTTCTGCGAAAACCCCTTGGCCACCAGTCGCGCCTTGAACCGCTCAATCTCTCCAGCTTGGTTCTCCTTCACGCGAAACACCCATCTGC
AGCCGATCGCCTTGCGTCCCTTCGGCAGTGGTACGACATCCCACGTGTCGTTCTTGAGCAGCGAGTCACACTCCGAGTCGCACGCCTCCTTCCACTTGAC
TGCGTCGCTGGATTCCATCGCCGACTTGAACGTGGTCGGCATTTCTCCCACTGAATCCACGACGTACGCAGCTTCGAAGTCTTGACTTTCTGATGGAAGG
TATGGATCTTGGACACCGAAGCTTGACGGAGCGGAGGGAGGGCAGCACTCTGGGCGAGACCGGAGCGGAGACTGGAAACCACTTGAGGGGTAGAACGAAG
ATTCGAAAGTGATTGATTGAGGTCTTTAGCTCGCTAGCCTTCTCGCTACTCTAGACCTACTGGATACACACTACTTGATTCTTTACTGGATACTGAGTTA
CTTCAGCCAATGAGAGAGCGCCACGTCGAAGCCCATCTTGTACCTACAATCTTGTACCCACAGGTGGCGTAATCGACAGTGGCGTAATCGTCGGTGGCGT
AATCGGCGTGGGTTCGGATTGGACCGGTTCGGGTTAACCGGTTCACGGTCAACAACCGATACCAAACCGGTAACCCTCCATACCCTCAATACGCCCCCTC
AATGCGAAGTCCCATGAATGCCGAGAGCCGCCGTCAGCTCCGTGTGGCGTGGTCCCGCAAGCGCCTTCGTCATGATGTCCGCCAGCATCACAGAAGTCTC
GCAATACTCGAGCTTCACTTCACCGCGTTTCACTTCGTCGCGGATGTGGTGGTACTTGATGTCGATGTGCTTGGCGCGGCCGTGGTTCACCGGGTTCTTG
GTCATCTTGATGCACGACTGGTTGTCTTCGCGGATCATGAGCTCGGGTCCCGTGTCGTTGGCAGCCGCCAGAATCTCGCACAGCAGGCGATGGATCCACT
TGCCCTCTTGGATAGCCAGACTGAGCGCGATGTACTCCGCTTCGCTCGTGGACAGCGACACACTTGACTGCTTCTTGCTTCCCCAGCTCACAGGCGCACT
CATGAGCA