Description :
From Genome Similarity Track
Location :
Scaffold_115:173717- 177436
Sequence
3719 bases(100 bases per row)
CGATGAGGACGCTGACGACGACGACGATGACGACGAGAGTCCAGAGGATTCGGAGGAGGCTCGAGCCGCTGAGGATGCCTTGGAGGAAGACACGCGACGG
GCTCTATCCCAATCTCGATCCGAAGCCCGGCGGAGATCCCTCTCGACGCCGCCTCCACAAGTCGCTGGCACAGCCGGATCCGGAGGCGACACTGCGGGAT
CCGCGATCCAAGTCGACAGTGACGGCGGATCGGGTAGCGATGGTGGGAGGGGGTCACCTCGTGGTGGCGGACTCCTTGGATCTGGCGGAGGGGGGTCGCC
TGGTGGCGGGTCCTCCGGATCTGGTGGAGGGGGGTCGCCTCATGGTGGTGGATCTCCAGGATCGCCCCATGGTGGCGGATCCCCGGGATCGCCTCACGGT
GGCGGATCCCCTGGATCTGTCTTGATCCCCGCCCCCCCTAACTCGTCACTGCCAGGGATGCTCCCCGTGGCTCCGTTCGGTCCGGATGCTGCTTTCATTC
CTGGTAGACGTGCTCCTGTGGCCTTCGCTGCCAGAGACATCGAGCCTTGGTCAGCCAAGAAATTGAACCGAGTTGCGATCATCTCCATGAAGATCACGGT
TCTGTTTCCGGAGTTGCCTTTTCGGGCTGAGTGGATATTCCCTCGGACAGCGGACGCCATCCCGAGGGCCGGGTACGTGGATTCGCTCATCACCAGACCC
CTCGTGGAGGAACTGACAAGTGCTGCCCCGTGGGATACGCTGGTCACCACACCGGTGGATCCGGTTAGCTTCAGGGGTGATGTGCGTGGGCGACTCGGGG
TATTCGTTCGGGCGTTCCGGGATTTCGCCTCCAAGCACCGGGTTGCTATATGGGAGGGCACTCACCGGTTCCCCATCTCTCGGAATCAATTGCAGGGTTC
GACCTGGTTGTCCAACCTCAACAAGCAGCGTGGTAACCGGCGTATCCATGCGGGCCGAGCTTGGAAGAGAGTCCTTGTGATCCTCGTGTTGGCAATCCAG
GACGGTTGGTGTGACGTGGATATTTTGCTGGATCCATCCTTCTTGCATCTTCCCCGACGCGGGGATAAGGTAGCTTGGTTTCCGGGATCCGTATCCCGTC
AAGCCAACTTGGAGGATCCCAACCTCCATCGCCCAGAACCCGTGAGCCTATTGGAAGCCTTGCGAGAGATCGACGAAGCCGAGCCTTGGCGCATCCAGTT
TCGCGGGGACCTGAGCCAACACCCAGGACGCCAGATCCAGCGTCTAGTGAGCAAGTTCTTCAATGTTCAGCCCAAGACTACCTGATCCTCATCATTCTTC
GACACCACGCCCCAGTTTCCGCCTTCGTGAATTCTTTCGTAGCAGTAACTAGCGACTGGATACTGGGTCGAGCTAGCCTTTTGCATAAGCTATTATAATC
CACACTTTCTTACTTGAATATGCTTACAACATTCCTTCGTCGGTTGAGAAATTTAATCCACCCTTTCAGCGAACACCTGGATCTGGGCTGGATCCACCCT
TTCAGCGTACACCTGGATCTGGGCTAGATCCACCCTTTCAGTGTACACCTGGATCTGGGCTGGATCCACCCTTTCAGCGTACACCTGGATCTGGGCTGGG
TCTGCGCCTGGATTTCATCCGGATCTAGCGCCAATGACCCAGGTTCAATCGGGTCAGTATAGTTCGGGCCCTTGAAAGCTCGTGCTCGAAATCAAGCAGG
ACTCCTCACACGTAAAACGTCACTCTTATGCATAAACATTCACTTCTTCCTCCTAATCCACCCTGTGGATTCGTCTTCTCTTTCTTTCCGATGTGACCAA
CTCATATCAGCGATCCTCCTCCTCCTGACCCACACCCTTCCTGTGGGTCCTTCTTCATCCTCCCATCGATATGACCAACTCACATCCATGGGTCCCCTCC
CTACTCTTCTTCATGAGACTGCATCACGCCGAATCTGTTACGATTCGTACGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNN