Description :
From Genome Similarity Track
Location :
Scaffold_56:17371- 21342
Sequence
3971 bases(100 bases per row)
TGGAAGAATCTTTTGGAGAGTTTTCATATGCAATAAGGGGGAAATGATATGTCGGTCGGGAGACATTATTACCAGGCAAAGTAGCGATCGGAAGAAACTC
CTCTGAAATGTCTGTATCGGTTGAATGTAGAAGTGATACGAGTCAAGTTGAAGATTTGAGACTGGTCGTACACTGTCCGTCAAGAACATGTCGAACATTT
TATTGAGATATTGGACAATCACGATTTGGCCAGACAACTGACGCGGTTATGCCTTGAAATTTGGACGAGATGGAAGAGATTTCGCGAGCGTACGAATGGA
TGATGCTGCGATAAACCCAAGCGCCGATCGAACCGCGTAAATATTGACAGCTACAAGCTTCGACATCCGTCCCGAGTCCCCAGGGCCGGCTGGTGCAGCT
AGTGCGATCCATGTTGATAGTGATAGCAGCTATTTGGGCTCAGATTTTAGTGGATTAGATGCCGAAGTGAACCAACGCAATGTTTGTGTGGCCACTACTT
CCTATCGCGCAACGAATATTGGCGGTTAACGAGGTAGACAGGAATCATCGGGGCACGATCACGATCAAGATCGTAGGGTACTACCGAAGGCCTGTACCCA
ATATGGATCGAGAAAGCAGGACGATGGCGTGTTATGGAAGAGATTGACGTGCCAGATATGTGGCGGAAAGAGATATCCTTCAAAACATTGCTTTCTATGC
GTACGTCGCTTGCGGTGATGTTCTCAATGGCGTTGAGTGTCCGATAAAAGGGGTCACAACTTGATCCGTAAGCGATTCGTCCTTACCACGCATGCTGGAA
TGCTACTACCGAATGCGGAAGAGATGCAAAACTGGAAAGCTCGCCAGGATAAAATCTGGTACGATCCGAGCGTTTTAGCCTCTAAATTTATGTATGTGTT
GAAAACAGATCTATGTCTTAAGGCGTTTAACAAACAAATCGATCCGACAATAGATCTGGTAATTCAACAAAATCGTGCTCAGTTTTTGACGTCTAGAAAA
TTGACGAGTACTTACGATCACCAGTCAAGATAAAGCTTGATCTAGGGCCGGGCGAAGGAATATTGAGAAAACCATACCTCAGACAAATGGTTCAAACAAA
CCAAACAGTGGAAAAAATCAACAACTACAAAGCCACCATGCTGTTTGACTCCGGATCCAAAGTCTCGTTATTCTACACCACCCTTTCTCGCAAAGTAGGA
TGTGTCAGTGATGGGGTCCACAGAAATGAATGTGTGGGAATTGGCGAGAATACGCATATGACAGAAGGACGCACCAAGATCAGGATGACTTAAAGCGGAT
CGCTGGTCCAATATTTGGTGTCTGGGTGGGGCGCCAAGTTGGCCATGAGGCGATCCTGGGCATGGACTTTATAGAACCAGCTGAAATACGTTCAGATCTG
AAGGATGAAATTCCTTGCTTACCTGATGAAGTTAGAATTCTCCAAGTCAGACGAAGCCATTCGTACCTATCCACAATACAAGCGATCATGGATCAAGACA
AACACGTATAGATAGCAGTTGGTGGATTGACAGAAGTAAATATCGGGATTAATTTCCCCTAAGCCTTAACTTAAGGTGAGGCGAGACCTGAAATGGGTAT
CTATGGTATATACTGGGTCATCTCGGTTCAGGTTTTTACATCTGACCAGCATCTTCGGTAGAGACATTATCTTCGACATGGCATTCAGAGAGGCTGGTGG
ACGGCTGCTGACATGATACCACGGTCTCCAGTTTGTGTATCAATGGGATGGCGCAGGTGTAACGACTGGTATCAATTTGCAGTCTAGCGACAACAGAACG
GGAGGGTGAACGACCAGAAGAGTATAATGGGCTGCTAGTAGATCACCCGTTATTAACCGCGCCAAAGAAGGTTCTGATTAGTGCTACAACGCAGTCGGAG
AGAGAAGGAAGAAAGAGGCGACGATCGAGGGGCACTGTGATGAAGACGATACTACGGCGGAAGATGTACATCCAGGACCGACGATATCGATCTCCTAACT
AAACAAGATCAACGATCGACGATCTTCCCTTTAGTGATCAACGTGGTCGGGGAAGTTAGAGATGTTGGTCAGGTACAAGATCGATAGGGTAAGAATAATA
GTGATATAAAGGCGATCGCTATCGACGAATACTATTTTGAAGAAGCAGGTAATGTACCAAAACGATCCGATTAGGGGAGCAACAATTCTGCCGCAGTCAT
TACCGAGGAAGTTTCAAACGTCAGATTATCACCCAAAACGTCCGTGTACTACCATGAAATTGGTAAGATCTTTGGTGAAGATGTGGATTAGCACATGACC
ATCCTGCCGGAAATTATTATTCCTACTGTGGGTGGAACGATCGACGACATAAAATTGACTATCCAGCTGGACCACTGAAAATAATATAAAAAGGTGGATC
AACTGATCTATGAAAACCGTCATCTACTTATTCAAAAGGGCAATAACATTCATTTCGGTGCACGGGGGTCAGTATGTGTCATCAATGTCGGAGGGACCAG
TCGGATTGGGCAAAGATCACGACCCGTGGCACCCAAATTTCGAGAAAATGACGAATATGATTTAATGTTATGTTCAGCCAAGATGATCCGACCATTCACG
TCGCCATGTTTTTTTTAATATATGTGCTTTATTAGAAATACGGTGTAGATATCTAGATGCGCATTGATTACAGGTGGGTGAATCAGCTGAAAAGATTGAT
GGTATACTAAATGCTGCTGATCATCGAGTTACTTCAAATTTGATTAAAGGGGTGATTTATTGTTCTATAAATACTGCAAGAGATTTTAAGCGGTGGAGAT
GAAGGAACGATCTTGAAATATCTCTATATTTATCACATCATCAGGCTTATTAAACGGTTACGAGTGCCGTTGGTCCTAAAACTGCTCTTCAGATATTGAT
CTATATAATATACCTGAAGATCGGTACAGAACCCCAGTCGATTGCCAGGAGTTCGTTATACTGGGTAACCAGTTTACCTATGGTGAGCCGAATACATACC
CACAGTCGTCAGTGCTGGGTCAGAGATCGCATTTAGACGATATCGACGATATCGACAATATCTTGATACCTGCTACGTCGTGGACCTCACTTTATGAGAA
GGTAGAATAATTGTTAGAGGTGTGCAATAATAAAAAAATTGGAAGTTTTCGATTGGAGCGACAAAACGTTTTTGGAAGCGTCGAAAGGTTGAGTTAATAG
GTCAGCAGATTTTGCTGGATGGTCTAAAAGCTCACCCAAATCTTTTTATCGCTTGTAGACGTTCCTTTTCTCAGATATTGCAATAGTTGCAGTCATTTTT
GGGGAGTTTCAACTATTGCGGTCGATTTATCGAAGATTTGCAATTTATGCGTCCGTTAACTATGAGCTGCGGACGGCTGATTTCATGAGATAGTCATATG
GGTAGGGGAATTTACCGGGAAACTAGGTTTAGGCGGCCAACAATACTACAATAAAGTCGGAATCGATCGAAAGATAAACGTCAAAGCTAGACACAATCCC
AACCGTACCCCTAATACTGGGAGCGATCCTGATCCTGACAGTAAAATCATTGGGAAAAGGCTATAATCGCGCTCACAATACTGAAGGAATTATTTGCGCA
GAATTGGATCCTCAAAAATAGTGTGATATCGATCACCAGTGATTGTAGTTTATGCCAGTAAGTTAGCGGTAACAGCCGCGCTGGTTCAAGAACATGGTGG
TGTATATTGACCGGTAATTTTCAGAGCCGTACGCTGAGGCCAAAAGCAGATAAATATGGGATGTTTTGGAAGTAGGTTTTATTACTTCTCCGATTTCTTG
ACATCTAATAATGGTGCTGGTCTCGCGTGAAATCGGAATTCACGCAATACTCTACATTAGCCCGATTTTGAAATTATCTGTTCCTGACGAAAGGTTGGGG
AGATGGGCCGCACTACTATCGAACTGGGCACTGGAGATTGGATGATATACAAATGGTGAAGACTCTATACT