Description :
From Genome Similarity Track
Location :
contig_11:1737- 2944
Transcript NameFunction/comments
g3003.t1OWZ00175.1 Integrase, catalytic core protein, partial [Phytophthora megakarya
g3004.t1hypothetical protein

Sequence
1207 bases(100 bases per row)
TGACATCCATCTGGTGCAGCTTGAGACCATACTTGGCAGCTAGACTCAGTACGATCCGGATGGACGTGAACTTGGCCACTGGTGCGAAGGTCTCGTCGTA
GTCGATGCCGTACTTCTGCGAAAACCCCTTGGCCACCAGTCGCGCCTTGAACCGCTCAATCTCTCCAGCTTGGTTCTCCTTCACGCGAAATACCCATCTG
CAGCCGATCGCCTTGCGTCCCTTCGGCAGTGGTACGACATCCCACGTGTCGTTCTTGAGCAGCGAGTCACACTCCGAGTCGCACGCCTCCTTCCACTTGA
CTGCGTCGCTGGATTCCATCGCCGACTTGAACGTGGTCGGCATTTCTCCCACTGAATCCACGACGTACGCAGCTTCGAAGTCTTGACTTTCTGATGGAAG
GTATGGATCTTGACACCGAAGCTTGACGGAGCGGAGGGAGGGCAGCACTCTGGGCGAGACCGGAGCGGAGACTGGAAACCACTTGAGGGGTAGAACGAAG
ATTCGAAAGTGATTGATTGAGGTCTTTAGCTCGCTAGCCTTCTCGCTACTCTAGACCTACTGGATACACACTACTTGATTCTTTACTGGATACTGAGTTA
CTTCAGCCAATGAGAGAGCGCCACGTCGAAGCCCATCTTGTACCTACAATCTTGTACCCACAGGTGGCGTAATCGACCGTGGCGTAATCGTCGGTGGCGT
AATCGGCGTGGGTTCGGATTGGACCGGTTCGGGTTAACCGGTTCACGGTCAACAACCGATACCAAACCGGTAACCCTCCATACCCTCAATACGCCCCCTC
AATGCGAAGTCCCATGAATGCCGAGAGCCGCCGTCAGCTCCGTGTGGCGTGGTCCCGCAAGCGCCTTAGTCATGATGTCCGCCAGCATCACAAAAGTCTC
GCAATACTCGAGCTTCACTTCACCGCGTTTCACTTCGTCGCGGATGTGGTGGTACTTGATGTCGATGTGCTTGGCGTGGCCGTGGTTCACCGGGTTCTTG
GTCATCTTGATGCTCGACTGGTTGTCTTCACGGATCATGAGGTCGGGTCCCGTGTCGTTGGCAGCCGCCAGAATCTCGCACAGCAGGCGATGGATCCACT
TGCCCTCTTGGATAGCCAGACTGAGCGCGATGTACTCCGCTTCGCTCGTGGACAGCGACACACTTGACTGCTTCTTGCTTCCCCAGCTCACAGGCGCACT
CATGAGC