Description :
From Genome Similarity Track
Location :
Scaffold_88:173673- 179201
Transcript NameFunction/comments
Phyci_11684Hypothetical protein

Sequence
5528 bases(100 bases per row)
CGAAAGCGACTCTCTCTTGAGCAACACAAGGAATTGAAGAAAAACATTGTGAGCTGCTACAAGCGGATCCTGGATTTGTTGGTAGCGTAACCGCAATAGA
ATTTCCCAACAGCCAAGCCCTTATCCGCGTCTGCAGGCCTCCACAGTAACGCCATCTGCTGCAGGTGCCAACCGTCGCCAACCCCCAGGTGGTGCGCCCA
CCCCACATTCTAATTCCCGTAAGAAGCCCGATCAAGGATCGACGTCTACAACAACCCTGAATAAAACAACAAGACCCTTGTTAGAGTACTGAAAGCTCTC
GTCAACCGAGCATCGTGTTCACCAGTGTCATCATGTTCAATCTGGCGAGCTTGATGGCCTCACTAGCACTTGGAAAGCTACACGTGCTGCGAAAAAAAAA
ACGCACATGAAGCGACTCCAAGCAGCATTACGCTCACCGGACGTGCGTACGAATCCAGCATTACTGACAAGGATGAGGATGACGGTACTACGGTGGCACA
CATTTGTGATCTGGCTGTGTCTGCCTCACTCTTAGATTCTAGGGAAGATGGTTCGCTCGTAACGCTTCTTTTGATTTATttgatcttcaatcttgcacgg
agtgcggccacatccaggcgatagagataatccagcaatgattcatccgatcgcgtacgcgcatggtaatattgctaccccgagcttacaatattaaatc
tggaaaccacgcaataaatagctccatttcgagtcgatagggcaagctgtaccaatttctggcaggtctagtcaacagatcggctcaggtaagccatatt
tcatcatcTGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTGTAGCATTACGATGCCACCGCCCCGAACGAAGACCAAACGCACGGTC
CGCGAGCCGACCCTGGCCGAGGTCCGTGCCTCCTCCGCACGCTGTTCCAGTTGGACAAGCTTCGCAAGGCTGAAAGTGGCTCGCGCCGCCGCGTGAACGC
GCTGAAGAAGCACCCGGACGGACTGAGGCATGTGGATGACGACCCCTTTGCGGAGGAGTACCCGCGTGACTGAGCTGTTCTAGCCAACAAAGGTTATCAG
GGATTCAGTAGCGTCTTCCGGGTGATCCACCCGAAGCGCCAGATCCAATTGAATCCGTTGACGTTGGAGAAGTCCCGCGACAACGACAGGATCTCGCGCG
ATCGCGTCGTCGTGTAGAACTACTTCGGTAGGATGAAGTTGTTGTGAGGCGTCAGTGCCGATAAGTGGCGCGGGGACGGGAGCCCATATGACTTCTTTTT
TTTGCGTGCCTCGCGCTTACTAATGCCCGCCCGCGTATTCGATCTCTTCTTTACGGAAGAAGGTCCTGACGATCAGTGCTACGAAGCGCGTCTACATGGC
ATTGGCATTCAATCAAGGTGCGAGAGATGGTAAGACGTGTCAACTACCGGCTGGGCAGTGATCTCCCAAGCGCGTGGTGACGAATCGTACGAGGTGTACA
AGCCATATGGATCCGACGCCGAAATCGAGAGATAAATGGCAGCTTCGCGTTGGCAATAGCGAATGGAATACAGCGCGTTGTTGTTGTAATAGGAAATGCG
GTCGTGAAAAACTAATAACGATAATATATAATTGGCTTGAAGCACAATCTGTAGATTCGGGTTGTTTTGTACCGTattgcgacattgatgtttgagtagg
gtagggTGCAAAATACACTATCAAATATCATGTCAACCCGTAATACTCTTAATCACACGATGTGCCATATGTTTGGTACAAGCGATCTGGGACGTCGAAT
CCGACGCCACTAAACCCTCCCAACGCGGGGGCCAAATCGATCTAAGTCCTACGACTGGAAATGCAAACACGAGTGTGCTCGTTCGTACGCGGGTGCAGCG
ACCGTACGTATTAGACTGTATTGCAGCAAATGTTGGTCAACAATATCCTGTTCGACCTTGTCAATGCAACTGGTTAGCAAACCTAACTCTGCCAGCTTCT
CTGCTAAGTTGTCATACTTCTCAGCTAACTTTGGATCCAAACCACTATCCGCCTCCACGCAGTTAAACCCGTTCGCTACGGTGTTGCCGACATGTCGCTC
CACCCGTCCGCGATCCACCCGGTTACCTACTTTCTGGCAGGCTGTGTCGGCTTGAAGGCGCGTCCGACGGCCTGATCCagctgatattgcggatccttca
cccacaagctgcggatccgttgcttcag