Description :
From Genome Similarity Track
Location :
contig_11:1736- 2943
Transcript NameFunction/comments
g2533.t1Integrase, catalytic core protein, partial
g2534.t1hypothetical protein

Sequence
1207 bases(100 bases per row)
TGACATCCATCTGGTGCAGCTTGAGACCATACTTGGCAGCTAGACTCAGTACGATCCGGATGGACGTGAACTTGGCCACTGGTGCGAAGGTCTCGTCGTA
GTCGATGCCGTACTTCTGCGAAAACCCTTGGCCACCAGTCGCGCCTTGAACCGCTCAATCTCTCCAGCTTGGTTCTCCTTCACGCGAAATACCCATCTGC
AGCCGATCGCCTTGCGTCCCTTCGGCAGTGGTACGACATCCCACGTGTCGTTCTTGAGCAGCGAGTCACACTCCGAGTCGCACGCCTCCTTCCACTTGAC
TGCGTCGCTGGATTCCATCGCCGACTTGAACGTGGTCGGCATTTCTCCCACTGAATCCACGACGTACGCAGCTTCGAAGTCTTGACTTTCTGATGGAAGG
TATGGATCTTGACACCGAAGCTTGACGGAGCGGAGGGAGGGCAGCACTCTGGGCGAGACCGGAGCGGAGACTGGAAACCACTTGAGGGGTAGAACGAAGA
TTCGAAAGTGATTGATTGAGGTCTTTAGCTCGCTAGCCTTCTCGCTACTCTAGACCTACTGGATACACACTACTTGATTCTTTACTGGATACTGAGTTAC
TTCAGCCAATGAGAGAGCGCCACGTCGAAGCCCATCTTGTACCTACAATCTTGTACCCACAGGTGGCGTAATCGACCGTGGCGTAATCGTCGGTGGCGTA
ATCGGCGTGGGTTCGGATTGGACCGGTTCGGGTTAACCGGTTCACGGTCAACAACCGATACCAAACCGGTAACCCTCCATACCCTCAATACGCCCCCTCA
ATGCGAAGTCCCATGAATGCCGAGAGCCGCCGTCAGCTCCGTGTGGCGTGGTCCCGCAAGCGCCTTAGTCATGATGTCCGCCAGCATCACAAAAGTCTCG
CAATACTCGAGCTTCACTTCACCGCGTTTCACTTCGTCGCGGATGTGGTGGTACTTGATGTCGATGTGCTTGGCGTGGCCGTGGTTCACCGGGTTCTTGG
TCATCTTGATGCTCGACTGGTTGTCTTCACGGATCATGAGGTCGGGTCCCGTGTCGTTGGCAGCCGCCAGAATCTCGCACAGCAGGCGATGGATCCACTT
GCCCTCTTGGATAGCCAGACTGAGCGCGATGTACTCCGCTTCGCTCGTGGACAGCGACACACTTGACTGCTTCTTGCTTCCCCAGCTCACAGGCGCACTC
ATGAGCA