Description :
From Genome Similarity Track
Location :
contig_8:173598- 175506
Transcript NameFunction/comments
g1816.t1hypothetical protein

Sequence
1908 bases(100 bases per row)
GTTAAGGAATACCAAGATGTCGTTTCCAACGATCCGCCTTCTGGCCTACCTCCAGATCGAGGCGTGCGTCATGAGATTGACCTGGTCCCTGGAACCAAAT
ACTGCGTAACAAGGCAGTGGCCCTTGCCAAGGGAGCAGTGTGACGTCATTGACGCGTTCTTCCGTGCGAAACACGAGGCGGGCATGGTGCGCGAGAGCAA
GTCTCCGCACTCGACGCCGACATTCTGTGTCAGAAAGTCAAACGGCAAGTGGCGCATTGTCCACGCTTTCAATAAGCTCAATGCCGCCACCATTCCGGCG
CAGACGCCTATTCCTAGGAAGGATGTTCTCCAGAACAACATGGTTGGATGCACAGCATACAGTGCGCTCGACTTAGTCGATGGTTATTACCAGTTGCTCA
TGCGTGCGAGCGACATTCCGCTGACAGCGGTCAGCACCCCGAGCGGGATGCTCTGGGAGTGGTTGGTGATGCCCCAGGGGCTGTCGAACGCGCCCGCGAC
GTTCAATCGTCTAGTGACGCAGCTCTTCCGGCCCCATCGGGCGTATGCACAGACATACTTCGACGACATTTTCGTCCACAGTCGTGCCGAGCACGGGAAG
TCAGATGTGGACAACCACATAGACCATTTGCGAGCGGTGCTCGAGTGCATGCGCACTAATAAGCTGTACGCTAACGCATCCAAATGCATCTTCGGTGCTG
AAGAGATCCCCTTCTTAGGGTGCTTCATCGGGAAGCGCGGCCTTCGAGCGGATCCCTCTAAGGTCAAAGCCATTGTTGACTGGCCGGTTCCCAAGAACCA
AAAAGACTTACGCAAGTGGCTTGGCCTCGCCAACTATTTGCATAAGTACAGCGAGAACTACGCTGATATGGCTCGGCCATTGTCCAATCTCCTTAAGAAG
GATGCGGAGTGGGCCTGGGACACCGAGCATCAAGTTGCCTTCGAGGCGGTTAAGGAGAGTCTCCTACACGCGCCGATCCTGGCGTTGCCAGACCCCGATC
GTCCGTTTAGTGTCGTCTGTGACGCATCGGACTTTGCCATCGGTTGTGCACTGCTGCAAGCAGACACCGAAGGGCGTGAACGCGTAATTGCGTTTGAGTC
TCGCCAGCTTAAAGCTGCAGAGAAGAACTATCCAGTTCATGACAAGGAGCTACTTGCAATGAAGTATGCTCTAGTCAAATTCAGGGTTCACCTGCTAGGC
TCTAAGCCATTTGTCATCTTTACTGATCATGCGTCACTACGCACTGCGACTCAGTCGCCTCACCTCTCGCAGAGGATGGCCCGCTGGCTCTCCTTCTTTG
CGGAGTACAACTTCGAGGTGAAGTACAAGCCTGGCAGGCAGAACGGGTTAGCGGACGCGCTGTCCCGCAGACCCGACTATGAGTTATCTCATGTCACGAC
TGTGACGTCGTCCGTGACGGACTTGATCCGCGCTGCGTATGCGCGTGACGACATGTGTGTCGCTCTGCTACGTGCTCTTGGGAGCAAGGAGTTTGGAGAC
TCGGACTGTAAGCTGTCGGCGCGCTTACGCGCGAGGCTGCATCGATATTCGCTCGATGATGGCCTGCTGTATTACAGCACCGATCCGGAGGATACTCCAC
GTATTGTGGTCCCTCACGATGAGGATCTGAAATATCGTATCCTCTATGAGGCACACGACACTGCGCTTAGTGGCCACCTTGGTCGTGAAAAGACCTATGG
CTCTGTGAGCCTCTCCTATTGGTGGCCCAAGCTTTACAAGTGGACGAGCACGTATGTGCGCACGTGTGAGACGTGTCAGCGGGTGAAGCCCTCACCGCAT
GCGGCCGCGCCGCTGGCAAGCTTGCCTGTACCCTCTGGGTGTTGGGAGTCCATGAGTATGGACTTTGTGTTCGGCCTTCCGAAGGACTCGGATGGCAACA
CGGGCATC