Description :
From Genome Similarity Track
Location :
Scaffold_21:173591- 175263
Transcript NameFunction/comments
Physo_3444651,3-beta-glucanosyltransferase, putative

Sequence
1672 bases(100 bases per row)
AGGATCGGTTGCTGACGAATTGGTGTGTGCAGGCCAAGTGGATGAACGAGGAGAAGGAGATGACGGACGAGATCGTGGGCAGCAACGTCTTCGAGTTCAC
GACGGAGATTGCTAACCTGGTCGAGAGCAAGAGTGCGTCCTGTTTCAGTAGTTGATGTTTCATCCAACCTTTTACTAACGGTTGATCTGTATTTGACCCC
TTTCAGCCCTCACCAAGACCGGCGACGCGGGCAAGTACGGCGTTGGCTACTTCATGCCGGAAGACTGCGACAACGAGCTCACCGAGTGCGTCTTCACGCC
CTACCCGGAGTACGACAACCTGAAGAAGGCGTACACGACCACGAAGAACTCCACCGTCGAGCACGACAGCTACACGCCTACGCGCACCGCCATCCTGGAG
TGCTCGAAGAACATTTCGAGCGAGCTGCCGCCTACGCCCAAGGGTAAGCTATCTCCGCCAACTCGTGTGACCGCAGCTTTGGGCTTGAGAACTCATCCTA
TCAATCCTGTGCATTGTTTGCAGTCCCCGTTCTGGAGTGCACCATCACGCAGCCCGTTTGCAACGGCATCAAGGGCAACAGCTACGAGCACCACTCCACG
GGCGCCGCCGTCGGTGAGAAGCGAACGCCCACGAACGAGGAGAGCAGCAGCGCGTCCATTACGGACGCCACCACGGGAAGCAGCGGCGCCAGTGCCACGG
CGTCTGCCGCGGCGTTCGTTCTGTCGGTGGCCACGGTGGCGGCCACTGCCATGTCGCTCTTCTAGAGCGTCAATTAGATCGGCCATTGCACGGTATTCAC
GTGCGAAGGCTCCTTGTAATGCGCTCCTATGGATGCCGTACTCTGTTCTCATGTAATGGTTAAAATGTACATGAATGTGATTGAAAACAATACGTATAGG
CTGCGTTCATGCTGATCAGAGCTCCTTTTACTGGACGATGTCGCTCCAGCGTCCGAGAAGACCCTTGTACCCCTCTGCATCCCGCACGGACCCGTCGGCA
TTGAACAGAACGCACGCCATCTTGGGATTTCCTGCGTCACCGTCCACGCCTCGGCAGAAAACGACGCCATCTCCCGGCAACTTGACCATGATGCGGCGGT
TGCCGAAGCCGAAGCCGTGTTCATTGCGGATGTTAAACTTGTAATCGCTGCCGTCCACGCCGCCGGAGAGGAACCGATTCGGGTGGTCGCCCACCGTGCG
CCAGTAGACGTCCTCATACCAGCCCTTGCGGTATCCTTTGAGGAACACATCGTCGTTGTAGCCCTTGTCACGCACCCGTGCGCCCGACTTGTTGATGACT
GCACCGTGGTGCGTCGACAGCTCCTGAAGCACCAGTTGCGCCGACGGGTAGTACCGAAGGATGACAAACTTCTTGTCGGCCGAGAAGCGGTTGCGACAGA
GCCTGGAAAATGACCGACAATGTAAGGGTTAGTTAGCTGTGCATCACCGTCAATAGATCAAACTGCGATGGCTTACCTCAACGTCGAGCATTACAGTCGT
TCCGGCCGCAAGCACTTGAGTCGGACCGGTGCACGGTGTGTACACGTCGAATTGGGCGAGGAAACTGGCCTCGCGAGCGCAGTCGGCGATGGAAGGGCCG
CTCCAAGCTGACGTGGGGCCGTCTGAAGGCACTGCCAGCACTTTGTGGCCAAGCCGGCGCAGGTTCTCGATG