Description :
From Genome Similarity Track
Location :
Scaffold_43:173585- 178312
Transcript NameFunction/comments
Phypa_INRA-310PPTG_14447hypothetical protein

Sequence
4727 bases(100 bases per row)
CGATCGGAGTGGATTCCCGGTTATCGTGGTCGCCGTAACTTCCGCAGCCACGATATCGTCCCCTGGTATGCGCAGGATATTCGTCAGACAAGAATCGTGG
AGATGGACGCGGATCTGATGTTTCATCACTTCGCCAAGCCGATGGAATGGCTAATCCCCTCCGCTGCTCCGCGCCTCCGCATGGAGAATGGCGAGACGAT
CTGGTGGACGAGAGCAACGTACGCGACTTGATCGAGTCTGCTCCGTGGGAGATCCTTGCTGCCAAGATTGATCCTCTCACGTCCGAGGTCGAGGTTAATT
CCGACACATGATGCGACTCTACGCGTCCTACGAGGATGAGCATCTTCGGGCTTATTGGGATTCTACCCACGCCTTTCCGGTGAGCATCGTCAAGCGTCGC
GCCAGTCGGTATTTGGAAGTGTTCTATACTGATCGCAAGCAACTCCGATCTAGGGAGGGCGCTGGTGGAAATCGTTCCTCCAACAGGTGCTGATCGGCTT
GCTTCGGGGTTATGGCGACCTTGACTTGTTGTTGGATCCCTTCTTCTTGCATTTCCCTTGACCAGGCGAGGCGGGTACTTGGTATCCTGGGGTTGAGAAC
GGGGTCGATCCTGTCGATCTGCTGGAGGCGTTGACCATAACGGACGCGGCCGATTGCTGGCGCAATCACTATCGCGACGTACCAGGGGACCACCCGGCGC
TTGGGATCGCTCGCTTGCTGGCAAGTTCGTGCCCTCCTCTTCCTGGTTACCTCCTGCCGTTATGTGTTGGGGTAGCAACTATTAGGTTTCGGCGTTTGTC
GAGAAGAAGAAATTTTTTGATGTAGTTCGACTTAAACCCCTTTCATTCTTCCGGAATTTTCGAGGGTGTATTGCCTAGGTTTTCCGGCCTATTCAGGCTC
ACAGCACTCCATATGCACCACCTCCTCCTTGAAATCTGCAGCCTTCCTGCAGATCCTTCTTCCTCTCACTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTCGCTTCTAGCGTAGATCGAGCGTCCCATCCATGGACCAAATAGAACGGCGTTTCGCCTCG
AACACGGTCGTACGTCCTGTTGAGGGCGAACGTCAGGCGCTCCGCGTACTCGTCCCAGTCTTTCTGATTTATATCTGCGACATACATCTTCAAAGCTCTG
GTTAGAGTCTGCACCATCCGTTCGACCGTACCATTGGCTTGTTGGCGGTACACCATAGTGGCACGCTGTATCTGTCCCACTATGCGGTTGAAGGCGCGGA
AAAAATCAGACATGAATCATGGCTCACGATCGTGCCGGATGGCTTCGCTTGCTCCAAATCTGGGAATACACATTCCTCGTAGCTCTCCGCGATCGTTTGC
GCGGTTCGTGACGCGCTGGCCTTGGCCATCACATAACCTGAGAAGAGGTCGACCCAGAAGAGCAGCTCGGTGTTCCTTTTCTACGACATCGGCAGAGACG
GGATGTGGTCCATCGCGATACACTGGAAGGGGTACGTCGCTTGTATGTTACCCGTCGACTCTCCTCGTAGAGTTGGGCGTCCCTTCCCGGTTTCACAATC
CGTGCAATGTCCCACGTATCGTCGTACACTCTTAAACAGACCGCGCCAGTGAAAGTGCGTCCTGATCCGCTGGTAAGTTCTTCCGACCCTCCCTCCAGAC
TTGTATGATAGTGGTGGAGTACATCTTGCTGCAAATCTTCCGGTTCCACTAGCTTCGCCAGTCGATCGCGGTCGCCGTCGTCTCTTCCCGCGTGCGTGCT
GTAAAAAAGCAGCCCACTTTCGTCCACGTCGTAGTCGCCCGCGATCTTGCCAACCGCCCGCGCCTCACCGCCATCCAACTCTCCAAAGTCGCCTGACAGA
TACGCATTGAGGTTTACGACCCATTTCTCTTCGTCTTGTGCTCGCTGGATCCGGTCCGTCCTGATGCGTTGTACCACATCCAGCGGCAGCACTTCTGGCG
AGTTCTTCAAACGTGTTCACGATCGGGTCGTCGCGGCCACCCGGCGACAGGATCGTCGTCCTTCGGGAGTAGGAGCTCCTGAAGCCGGGTAAGGACAACC
AAATCGTCGCGGTCCACTTCCGAGGTAACCGCTATGCCCTCTTGTTGGTGCAACGCGGTGTTGGCTAACCGATCCGCGCTCTGATTCCAGTCTCGTTTGA
CATGCAGGAACTCGTGGGCTGGCCACATTCTCAGCCGATCTAGTGCCCGTCGACGCACTCGAACTCGCCTCGCATCTGCCGGATCACCAAGTTGGAGTCT
CCGCAGATGATCAGGTGTCCCCGATCCAAGCCGGAGAGTAGATCGAACCCTAACAACAGGCCCTGGTACTCCGCCTCGTTCACAGTTAGGTCGGGCAGGT
ACTTCGATTCGGCTGCGACGACAATCCATTCAGGTAACTTCCACACGATTGCGCTACACGCTCCACCGCCTCGTTTGACTCGTGGTGATCCATCGAATTC
ACGACTAACAGTTCTTCAACCTGTTTGACCGTAGGTAGCACCACAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNCGGTCACACGCATTCAAGAGTCGATCTACTTTGTCGCAGAGAGATTCCCAGGACTCAGCCGTCACCAGGATGTCATCGTTGTTTGATCGGCGA
CCGAGTACCAGCGATTCGAAATCCGTGTCCGGCTCACCAGCTTGGAATACATCCACCGCGCCGGATTGGTCGCTGCCTTCTGGTATCGGGAGGTAGCCGT
ACAGCGCATTGTCCAAGAGTCGCGGATAGATCTGTGGCGCATTCTTCAACCCGAAGGGCATACGCAGCCACTCGAACAGGCCGAACGGCGTGATGAACCG
ACACCAAGCGGGCTCTCTCAGTCATTTCCATGACCCAGAATCTACTCGCCATATCCAGTGAACAGTACCAGAGCACCTTGTCCAAGTATTCAAGCAGATC
GTTGATCAGCGGCATGCGGTATACCACGAGGCGCGTCAGGCTATTTACGACGCGATAATCAATGCAGAGTCGGATATCGACACCGTTCTTCTTGATTATC
ACCACGATCGGCGACGCCCACGGAGAG