Description :
From Genome Similarity Track
Location :
Scaffold_43:173572- 181070
Transcript NameFunction/comments
Phypa_INRA-310PPTG_14447hypothetical protein

Sequence
7498 bases(100 bases per row)
TTCCACGGTTCCCCGATCGGAGTGGATTCCCGGTTATCGTGGTCGCCGTAACTTCCGCAGCCACGATATCGTCCCCTGGTATGCGCAGGATATTCGTCAG
ACAAGAATCGTGGAGATGGACGCGGATCTGATGTTTCATCACTTCGCCAAGCCGATGGAATGGCTAATCCCCTCCGCTGCTCCGCGCCTCCGCATGGAGA
ATGGCGAGACGATCTGGTGGACGAGAGCAACGTACGCGACTTGATCGAGTCTGCTCCGTGGGAGATCCTTGCTGCCAAGATTGATCCTCTCACGTCCGAG
GTCGAGGTTAATTCCGACACATGATGCGACTCTACGCGTCCTACGAGGATGAGCATCTTCGGGCTTATTGGGATTCTACCCACGCCTTTCCGGTGAGCAT
CGTCAAGCGTCGCGCCAGTCGGTATTTGGAAGTGTTCTATACTGATCGCAAGCAACTCCGATCTAGGGAGGGCGCTGGTGGAAATCGTTCCTCCAACAGG
TGCTGATCGGCTTGCTTCGGGGTTATGGCGACCTTGACTTGTTGTTGGATCCCTTCTTCTTGCATTTCCCTTGACCAGGCGAGGCGGGTACTTGGTATCC
TGGGGTTGAGAACGGGGTCGATCCTGTCGATCTGCTGGAGGCGTTGACCATAACGGACGCGGCCGATTGCTGGCGCAATCACTATCGCGACGTACCAGGG
GACCACCCGGCGCTTGGGATCGCTCGCTTGCTGGCAAGTTCGTGCCCTCCTCTTCCTGGTTACCTCCTGCCGTTATGTGTTGGGGTAGCAACTATTAGGT
TTCGGCGTTTGTCGAGAAGAAGAAATTTTTTGATGTAGTTCGACTTAAACCCCTTTCATTCTTCCGGAATTTTCGAGGGTGTATTGCCTAGGTTTTCCGG
CCTATTCAGGCTCACAGCACTCCATATGCACCACCTCCTCCTTGAAATCTGCAGCCTTCCTGCAGATCCTTCTTCCTCTCACTNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTCGCTTCTAGCGTAGATCGAGCGTCCCATCCATGGACCAAATAGAACG
GCGTTTCGCCTCGAACACGGTCGTACGTCCTGTTGAGGGCGAACGTCAGGCGCTCCGCGTACTCGTCCCAGTCTTTCTGATTTATATCTGCGACATACAT
CTTCAAAGCTCTGGTTAGAGTCTGCACCATCCGTTCGACCGTACCATTGGCTTGTTGGCGGTACACCATAGTGGCACGCTGTATCTGTCCCACTATGCGG
TTGAAGGCGCGGAAAAAATCAGACATGAATCATGGCTCACGATCGTGCCGGATGGCTTCGCTTGCTCCAAATCTGGGAATACACATTCCTCGTAGCTCTC
CGCGATCGTTTGCGCGGTTCGTGACGCGCTGGCCTTGGCCATCACATAACCTGAGAAGAGGTCGACCCAGAAGAGCAGCTCGGTGTTCCTTTTCTACGAC
ATCGGCAGAGACGGGATGTGGTCCATCGCGATACACTGGAAGGGGTACGTCGCTTGTATGTTACCCGTCGACTCTCCTCGTAGAGTTGGGCGTCCCTTCC
CGGTTTCACAATCCGTGCAATGTCCCACGTATCGTCGTACACTCTTAAACAGACCGCGCCAGTGAAAGTGCGTCCTGATCCGCTGGTAAGTTCTTCCGAC
CCTCCCTCCAGACTTGTATGATAGTGGTGGAGTACATCTTGCTGCAAATCTTCCGGTTCCACTAGCTTCGCCAGTCGATCGCGGTCGCCGTCGTCTCTTC
CCGCGTGCGTGCTGTAAAAAAGCAGCCCACTTTCGTCCACGTCGTAGTCGCCCGCGATCTTGCCAACCGCCCGCGCCTCACCGCCATCCAACTCTCCAAA
GTCGCCTGACAGATACGCATTGAGGTTTACGACCCATTTCTCTTCGTCTTGTGCTCGCTGGATCCGGTCCGTCCTGATGCGTTGTACCACATCCAGCGGC
AGCACTTCTGGCGAGTTCTTCAAACGTGTTCACGATCGGGTCGTCGCGGCCACCCGGCGACAGGATCGTCGTCCTTCGGGAGTAGGAGCTCCTGAAGCCG
GGTAAGGACAACCAAATCGTCGCGGTCCACTTCCGAGGTAACCGCTATGCCCTCTTGTTGGTGCAACGCGGTGTTGGCTAACCGATCCGCGCTCTGATTC
CAGTCTCGTTTGACATGCAGGAACTCGTGGGCTGGCCACATTCTCAGCCGATCTAGTGCCCGTCGACGCACTCGAACTCGCCTCGCATCTGCCGGATCAC
CAAGTTGGAGTCTCCGCAGATGATCAGGTGTCCCCGATCCAAGCCGGAGAGTAGATCGAACCCTAACAACAGGCCCTGGTACTCCGCCTCGTTCACAGTT
AGGTCGGGCAGGTACTTCGATTCGGCTGCGACGACAATCCATTCAGGTAACTTCCACACGATTGCGCTACACGCTCCACCGCCTCGTTTGACTCGTGGTG
ATCCATCGAATTCACGACTAACAGTTCTTCAACCTGTTTGACCGTAGGTAGCACCACAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNCGGTCACACGCATTCAAGAGTCGATCTACTTTGTCGCAGAGAGATTCCCAGGACTCAGCCGTCACCAGGATGTCATCGTT
GTTTGATCGGCGACCGAGTACCAGCGATTCGAAATCCGTGTCCGGCTCACCAGCTTGGAATACATCCACCGCGCCGGATTGGTCGCTGCCTTCTGGTATC
GGGAGGTAGCCGTACAGCGCATTGTCCAAGAGTCGCGGATAGATCTGTGGCGCATTCTTCAACCCGAAGGGCATACGCAGCCACTCGAACAGGCCGAACG
GCGTGATGAACCGACACCAAGCGGGCTCTCTCAGTCATTTCCATGACCCAGAATCTACTCGCCATATCCAGTGAACAGTACCAGAGCACCTTGTCCAAGT
ATTCAAGCAGATCGTTGATCAGCGGCATGCGGTATACCACGAGGCGCGTCAGGCTATTTACGACGCGATAATCAATGCAGAGTCGGATATCGACACCGTT
CTTCTTGATTATCACCACGATCGGCGACGCCCACGGAGAGCTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGATT