Description :
From Genome Similarity Track
Location :
contig_40:173559- 174744
Transcript NameFunction/comments
g9047.t1hypothetical protein

Sequence
1185 bases(100 bases per row)
CGGTTGAAGCACGTGTGCGCCCGCGGATACAAGCATTCGTCTGCGCTGACGCACTGGATCGCGAACGGGCAGATGCGTCCGTCATTCATGGTCAGCGCTT
TGAAGCCTTGTACTGGCACCCGCGCCGAGCCGGTTGTGAACTGCAGCAAGCGCGCCTTTTGCTCGTTCGTGAATTCATGGACGATATTCCAGAACCAGGC
GATAGCTCGCTCGTCGCGCTCCCCCACATAAATAGTGTGAGTCTTCCAGTCCTGCACGTCAATGTCGGGGATTCCACAAATCAAGAGCTCCAACTCCTGG
TGGTCGAAGACAGAGATAAGCTCCTTGGGAATAATTGAGAAGAGGCCCTGCATCAAGGATCCCAGCTGCTGCGATATGCTGTTTGCAACGATCCACTTGA
AGCGCAGGTTGACGTACTCCATCTTGTTCTCTTCAGTGACGGGGATGTTCGATCCGTTTGGTACCAAATCCACCACCTTCGCCTTGTCAGACATTTGGTC
GACGTTGACACTGGAAATGCACAAGACAATTTGTTAACATGACTGCAACTCAGTGGCTTGAAACAGAATACTACGTACGTGAAGTCCAGGGCCAATGATT
CTACACCCGTGTTGTCTCGCAACCACTTCAAATTCTTGTACAGGTCGTTGTCCACGAACTCCAAGTCCGAAAACGTAATGGGGATACCCAGAATATGCTT
GCATACCGGGAGTGCCAAGTGTGCATCGATGAGGATACCTTCGAAGAGCGCTCTACCGATGAAACGACCAATTGCTTGGTAGTACTGCACACACACACAA
ACAACTGTAAGAACACACCAACACATCGACAACTACCGCAAAGCGTACCATCAGGTGGTCAACACTGGCTTCAGCGGACGCAGGATTCACCATGAGTCCA
TCTCCGTTACCGCTTCTGTAGAACAGCCCAGTAGCATCATCGAAGACCTCCTTTGTCATCAGCGTAAACCATTCGCGGACCAGACCACCTGCATCCACGC
CCGGCTCGTTCGCGAACTTGATTCGAAGAGACTGGTGCAGCTGATCCGGAGTCGCCCATAAAAGCTGTTCGCACGAATTGTGGAGAAGGTTGTCACGCTC
GATCTCCAGCAACAAGTGCCCATACTCCCACGGAACCTCCATGGCAGCCGTGTGCTGCACAAACCACGCGTGCTTTTGCTGGAAG