Description :
From Genome Similarity Track
Location :
contig_40:173558- 174608
Transcript NameFunction/comments
g9047.t1hypothetical protein

Sequence
1050 bases(100 bases per row)
CCGGTTGAAGCACGTGTGCGCCCGCGGATACAAGCATTCGTCTGCGCTGACGCACTGGATCGCGAACGGGCAGATGCGTCCGTCATTCATGGTCAGCGCT
TTGAAGCCTTGTACTGGCACCCGCGCCGAGCCGGTTGTGAACTGCAGCAAGCGCGCCTTTTGCTCGTTCGTGAATTCATGGACGATATTCCAGAACCAGG
CGATAGCTCGCTCGTCGCGCTCCCCCACATAAATAGTGTGAGTCTTCCAGTCCTGCACGTCAATGTCGGGGATTCCACAAATCAAGAGCTCCAACTCCTG
GTGGTCGAAGACAGAGATAAGCTCCTTGGGAATAATTGAGAAGAGGCCCTGCATCAAGGATCCCAGCTGCTGCGATATGCTGTTTGCAACGATCCACTTG
AAGCGCAGGTTGACGTACTCCATCTTGTTCTCTTCAGTGACGGGGATGTTCGATCCGTTTGGTACCAAATCCACCACCTTCGCCTTGTCAGACATTTGGT
CGACGTTGACACTGGAAATGCACAAGACAATTTGTTAACATGACTGCAACTCAGTGGCTTGAAACAGAATACTACGTACGTGAAGTCCAGGGCCAATGAT
TCTACACCCGTGTTGTCTCGCAACCACTTCAAATTCTTGTACAGGTCGTTGTCCACGAACTCCAAGTCCGAAAACGTAATGGGGATACCCAGAATATGCT
TGCATACCGGGAGTGCCAAGTGTGCATCGATGAGGATACCTTCGAAGAGCGCTCTACCGATGAAACGACCAATTGCTTGGTAGTACTGCACACACACACA
AACAACTGTAAGAACACACCAACACATCGACAACTACCGCAAAGCGTACCATCAGGTGGTCAACACTGGCTTCAGCGGACGCAGGATTCACCATGAGTCC
ATCTCCGTTACCGCTTCTGTAGAACAGCCCAGTAGCATCATCGAAGACCTCCTTTGTCATCAGCGTAAACCATTCGCGGACCAGACCACCTGCATCCACG
CCCGGCTCGTTCGCGAACTTGATTCGAAGAGACTGGTGCAGCTGATCCGG