Description :
From Genome Similarity Track
Location :
Scaffold_62:173542- 175342
Transcript NameFunction/comments
Sapdi_VS20SDRG_13680hypothetical protein
Sapdi_VS20SDRG_13681hypothetical protein

Sequence
1800 bases(100 bases per row)
GCGACCGGTGCGTCCGCGGTCCTTGGGTTGAGTTGCACTTATCGCCGTTGCCTCCAGGGTTGTTGTCGTGCTCCAAAACAAGATTTACGTCTACAACTTT
GGTACGTTGTACATGCGATGGCGTGCTTGAGCACTCAAACGACGTCTCTTTTGTAGCCGATCTCAAGTTACTGGACCACATCGAGACGATCGCGAACCCC
AAGGGCCTTGTCGCGCTCTGCCCGAGCTCAACGAACACGGTCCTCGCCTGTCCCGGCGTCTCGCGCGGGACGGTCAGAATAGAGCTCTACGACCAGCGCA
AGACGACGCTTATCACGGCACATGAAGCCGATCTTTCTCAAGTCAGATCCCCGCAGCACGAGAGAGTCCTGACGCTGTGCCCGCTAGATGTGCCTCAACT
TGGAGGGCACGCGACTTGCGACAGCGTCCGACAAGGGCACGCTCATCCGCATCTTTGATACGCAGAGCGGCCAGCTAATGCAGGAGCTGCGGTACGCGGC
TATTGTGGAACGAGGGCGCCACTAAGCTGTGCTATGTTAGGCGTGGCGCCGACAAGGCAGAGATCTACAGTGTGTGCTTCAGTCCCAACTCGCAGTACCT
CGCGTGCTCGAGCGACAAGCACACGGTGCACATCTTTGCGCTGACAAAGGAAGGCGGCGGCGCGGAAGGCGCGGCGCCGCTCTCGACGTCGGCCCACCGC
AACAGCCAAACGGGGCAGCGCTACTCGTCCGGGTCGCTCACACAGTCGACGCCCATTGCCCGCGAAGACGACAGCACAGAAAACTCCAAGTCGAACTTTT
CGTTCATGCGCGGGCTCTTGCCCAAGTACTTTAGCTCGGAGTGGAGCTTTGCGCAGTTTCGCGTGCCCGAGACGCGGTACCGTATGCTCTGCGATACCAC
CATCATCATGCTCATGTATAGCACCATCTGCGCGTTCGGCGTCGACAAGAACACGATCATTGGTACAGCTCGCTCGCTGCGTCGCCACCTCATCCTGTTG
TCTAGTCGTTGGCGCCGACGGCTCGTTTTACAAGGCGGTCTTTGACGCGAATGGCGAGTGCGAGCGCACGTCGTACTCCAAGTTTATCCAGACCGAAGAC
GACGAGTAGGCCAACGCCGCCGTAACGTAACGAGCCGTACATGTACCAAGTCTGTGGGAGCGACTAGCTCTTGCGGGAGTACGGAGCGTGTCGGGGCACG
TTGGGGTCGTACTAGCAGCAACCGTAAGCAAGGAGATACCAGGCATTTGTTACCATTTCCCAGCGCGACGCGGGAAAGATGTGCTTGTTGCGCTCGTACC
ACAGGCGATGGGTGACCTTGCCTGGATGCGACTGCAGATCATGAGATGAAGTCGCGAAGTGATCGGACGCACCTCGTCCTTCTCGACGCGCACGTCGTTG
ACCAAGCGCACGTCGTCGTGCACGTCAAAGTGGAACAGCGGGCCGGTTTTGCCGCGGGCCTTGGTCACAATCAGGTCGTAGAACGACAGTTGCTAGCACC
ATGCAATGAGGGATGATACAAATGATGAGCCAGAGAGTACATGCGGGATGATGAGGTCTTCCTTGATGTACATGAGGTCGTCGATGCTCACGGTGCGAAT
GTCGGGAAACTCGGCCGCGAGCTCCTTGCGCACGAGCTCGAGGAATTTGCCAATCGGCGTCGCCTTCTCGACGCTTAGCTCGCGCCGATGCCCGGCGCCG
TCCCAGTAGCTGAACGTCACGCTCAAAAGCTCCTTCTTGATGCGATCTTGGGTCTCGACCCACTCTTTCTGCAGTGCGGCCTTCTCTTCCTCGAGCGCAG