Description :
From Genome Similarity Track
Location :
scaffold_226:17353- 18363
Transcript NameFunction/comments
g5944.t1hypothetical protein

Sequence
1010 bases(100 bases per row)
ACGAGCGTAAGGTACGTGACCAGCTCTTGATAAGAGCGGTATACAGGCAGGTCCAGGCGATTGAAGCACGTGTGAGATTTCGGATAGAGGCCGGCGGGTG
GAGTGCCGATGGTCACTAGCTGAAGGCCGAAGCGACGTATGCGGCCGTCGTTGCTTAGCAGTGCTCGAAACCCTTCAGCTGGCACACGAGAGGTACCAGT
CACAAATTGAAGTAAACGAGCACGCTCTTCCTGAGAGAATGCTCGAACGGCATTCCAGAACCACTTCACCACTTGGACCTCGGGGGCAGCAGGTTTATTG
AAACCTTGATCAGCGCGCATATAGCGGACATCGGTGTGTGATTCCCAGTCGACGACATCTATTGACGGCATACCGCACACAAGCAACTCCAGCTCTTGGT
AATCGAAGACAGCCAGAAGCGAACGAGGAAGTACATCATACAGGCCTTGAAGCAACGCCTCGAGCTGTTCCTTCACTCCACCGAACATTTTGTGCTTGAG
CAGCAGTGACAAATATTCTTCCTTGTTGGCGTCCGTCACGGGTATATCGTTGCCACCTGGTTTGAGCTCTGCTGTGATGATCGACCCGTCAATTCCAACG
TGTTGCGCTGTGAAGTCAAGTGCGAGGGCTTCGGCGCCTTCGTTATCGCGTAGCCAGAGTGCGTGGTGATGAAGTTCTGCATCCAGGAACTCGAGGTCGG
AAAATGAGATTGGCACGCCGAGCAGGTGCTTTAGTAATGGAAGTGCTAGGTGCACCGTCAAAAGTTGCCCCTCCAGAAGACATTTCGCTAGCAGCCGGCC
GACAAACTGGAAGCAGTGCAAGTGATCACGGTGGATTTCGCGCGAGTTGGGGTTTATCCAGTAGCCTGACTGGTCGGCGTGTGTTCGCTGGAACAGGCCA
TAGCTCTCGTCGAAGAGCTGTTCGCAGAGAAGCAGAACCCACTCGCGCAGTAGACCGCCTGCATCTAGCCCTGGTTCATCGATGAATTCAATCCGCAAAC
GCTGTCGGAG