Description :
From Genome Similarity Track
Location :
Scaffold_11:173521- 178506
Transcript NameFunction/comments
Phyke_g1519hypothetical protein PHYSODRAFT_507199
Phyke_g1520hypothetical protein
Phyke_g1521hypothetical protein PHYSODRAFT_508298

Sequence
4985 bases(100 bases per row)
GCGTACTCACTCCGTTGTGGTAGTCGGTAATTCGACGGTTCATGTTCGCGATCCGGGCTTCGTGTGCGATTCTTTCTTCGCGCATCCGCCGTGCAAACTT
GCTCTGTGCCTCACTTCGTATCTTCCTGAAAATGCCAGCCACCGGAGGAATCATTAGTGTGCGGTCCCAAGTACGACAATACAAAATGATACATTGTTCG
TACGTAGGGCTGCAAATTTGTAGCTCGTCGACTAGCATAGCACCAAAAAATTCAATCGTTTATGTGCTATTTCAAACTGGAAGTCGATGATTTTGAGTGC
ATGCATACCTTTCTCACCGCTGCTAAGCCCTGCACCTGTATGAGCTACCACATGTTTGAATCGCCGGAGTTCTGCTTGCGTCTGGAATcgaccaccagca
ttgcGTTCATCGAACGAGCAGAAACCCGCGTGTGAAGCGCGATTCATGTCCTTGACGCAGAAACCGATAGTGATAGCTTAAATCCTGAAGCCTCGAAAAC
CGCCCTGATTGCAAAGATGGAGTCGAGCATCCTCTTGTCGACCTCACCAGGATAAGATCATGTGCACAATCGACCACTGTCGTCCTTGCTTCATTCCCAC
TAAAAATACGATCGTCGTGGCAAAATGCTTAGCGTTCTCAGCGCTAAGCGACCCCACTACCTTGATCCGGGATAATTCGACTTAATGCTCCAAACGCACC
GTCCGATTGAGCTTAGTGGCAGTCATCATGAAGGTGGAATTGATCGGCATACCGAGATGAATCTCGAGGCACCCTTTGATTTGGGCCTTTATACACCCGA
ATACTTGCAGTCAGACACGCCGGCAAAGAACTATCGCGATGGTGATGCTACCTGGGAACGATTCCTTGCAGCTCAGCCGCTGTTGTATCTGCCTGACCGA
TCTCCTATCACGGAGGAGGATCCGATCgaccgacgacgaagacttTGGACCCATCAAGAACTTCAGGCATTTGGAGATGTTGTTGAAGAACGGACCCGTG
CCCAGCTGATTACACAAGAGCGCACTTTGCGACGATGGCACATTGCAGCGACGCAGATACAGCGCTGCTATCGAGGAATGCGCGACAGGATGCTTGTATT
GCGAATTCGACAAGAGATTTGTGAGTACGCAGCCACATTGGAGAGAGCCATGGAGCTTGCTCGTGTGCGACGAAGGCAGCACAAAGCTGTTGTACTGATT
CAGCGAGCGTACAAGCAGTTTCGACATTTCGTCCTTCATCAAGAGCGAGCTGCAACCGTGCTACAACGAGCTAGCAGGCGATTTATGCGCCGTCTAAGGC
GATGGCGGGCCCAACTGGTAATGCagcgagctgctcgctgtttCCTGTGGCGGACTCGCTGGCAACGATACAAAACGCTCGTGACTAAAATGCTCAGGGC
TGCAGCAAGACAACAAGAGCTTGTAATAGCCACGGAAGCTTTTCAGCGAGCACGCGAAAAAGCTCTGATTCAGCACCAAGCGGAAACTTGGGCTGCTCAC
TCAGAGCGCATGCAGATGTTGCTGCGAGTACGCCGACATAAGGAACATCTCCGGAACTCTGACATTGGTGTCTTTCCCCCAATTCAAATGCCTGCAGAAA
AACATCATACTCGTAACAAGACAGCAAAATCCACCATCACATCGGAGAAGCAGCATCAGTTGCCACCTATCTGCCATTCCATCCGTGGAGAATAAACTTG
AGATCCTTTAACTAACCGGCTGCCTACAGAAGACTTGTTGAAACACATAAAATGAAAGCTTGATCAAAACCGCTTCTTGAATTGGTTGCTTACTTCATCC
ACTCTATACACACGAAGAGGTAACTAAACGCACAGCATTAAATACACAACTCATTTTAGCGTGACGAACGTCGCCCACAGCTCCTCACTCACCCGACTGA
CAGCAGTGTTGATGGGGCATTCCTTTTGCGCGTTGGCCCTCGCCAGAGTGCCAAAGCTTCGAGacaccacatccagcaccGGAGGCGGCAACTGGTTCTT
GTGAATACGCCAAAACAGTTCAAGCCTTTCAGCGAAATTGAAATGCTCCGCACGGCGCTCACTTAGGCTAACGGAAGTGTCCGCTACGTCCTCCCCTTCA
GTTGACGGCGTTGCGCTATCAGGGCTACACGTGTGGTGGTCCCGACTTGGGGACATTAGTGACTGCAGTATATCACAAAAATCGTCTATGAAGTGTAGTA
TGTCGTTAGTAAGCACGCTCAGCTTGTCCTTTGCTGCGCACGCCTCGTCCTTAATTTGTTGGAAGGCGGACGTTTGCTGGGCCACCACACACGCAAGCTT
CAGCACCGCCTGAAACAACTGGTGTTGGTGAGCAATTCCCCTTTGTTGTCGCTTTAGAGCAGCCACAGATCGAACCTGGCGCGCGAAATGAGCCTGGATA
GCATCCGTCTTCGCGAATGCCTCATTAAAAATCTGAAATGCTCGATCTCCTGGTGCGAGATCGAGCCGAGACATTCTCTTTGCGCAGCGTTCAAGTTCGT
CACAGCATTTCTGCGCAGAATTTTCCCTCTCTTCTGATTCCAGACCAATATTCCCCTCGatttcttcaatttctcGAGAGCACTGTGCAATTAGCCCTTC
CAGCCAGGCCATCGTCCTGTCAATTACACTCTGTCTGCCGCTAATTGCCGCCCGTATTTCTGCTAGCAAATAGCTCCACTTGTCCATCAGATACAGTAGC
TCCTGCATTGGATCTGCTGAATTCACTTTCTGGTCCATagtcatctccatctccattgGCAGAGTCTGCACAAGGCTCAGCACCTcacacagcaccacag
caagcgcttcatTGGCTTGATATCGTCTCGCTCGGCCTTCTGAgatctccagcaactgtCCAAGTTCCTCACAAGCATCTTGAAGAGCACGACATACGTC
AATTGACGGCGGAATGCGCATCTCCCGCAGTAAAATAGAGATCTCTTGGGTtttgtccagcagatcgcgaTCTTTTGCGAGCACTAGTAGACGCGTCACA
ACGTTAGACCAGGGCAAAGGCTCCGCCTGATTGTTCTGCGTCATTACTTCGTCATCGCtctcgtcgctgctgatcTCAATGACCTCAGGAAGCGCGTCTC
GGCTGGTCTCCATGGCGAGGGCCTTGAAGTCTTGGTCGCAACTGAATTCACTTCAACTCTCTTTATGATAGTATTCTTATATATGATAAAATGTTCTTAT
ATGGAAATGCGTTTTTATCAATTTCTGGAGTTCATGGGACAATGTGCTTTTGTCTCCTTAGCATTGGTTCAAATGGCCTTGTGGTATGATCGTCTTTCAA
TTGGTTGAAATGTTGTCTTGGACCGGTCTGGTCAACGGTTCAGTGAACCGTCGGAGCCAGTGGCGTTGAGAAAAACGAGGGGAGAAGGGAGAGAAACCCC
CGCCGAGCCCCATACATaaatcaagaagaagcgaacACCAGAAGCTATAAGTGAAGAAAGAAGCCTCGCTTAAGCGCTAAAGCAGCCAGGTCTTCCTATA
CGTTCCCCATCGACTGTCTTTGGAGTCCAACGCCTCGTAGTGATCCTGTCGAGCGTCTGTTTCCTTAATTCACCTCATTGAGAGTCTCGACTCGCCGTCC
TCACCCGAAGAAGCGGCGTCTTTGTGTCTTCTCGTCCCGTCACCCGTCCGTCGCTGCTATCTACCGGTAGTCGTCTGGAAGCGAGGGAAAGAAACTCCGT
GTGGGTTGCTTTTGTCCCTAATTGATCGGTCAAAGCATTGACTGAGCATCACAACAAACTACTAGTTGAAACCAAAGGTAATTGAAATCAAGTATTTAGA
ATTAGGGGGGAGGAGGCATACTATGCTAACTCGCCTGGCATAccccaccaccaacacgcaCTCGCATTTCCGCCGCTGTCTCTCCCGCCCTTAAAGGGGC
TCAAAGTGATGTCCATATATGAGACGGAACAGTCTTGAGGTGGCGATGACAGAGGTCTTTTAGTCCCTCAGGAGTTCATTGAGCCACTGAAGAACTGTGA
TACAAAGTGGAAGGGAGAGGCTCGATGGAAATGTCGACTGGTGTGAGGGCCTGCTGGTTTGTGGAGGTGGCTAGTTACATGACCGAAGAACTCACTTTTG
GATGCAAATATGTGCCAATTCTCTGGATGTATAGATCATGAACGTCAACATGGAGCGAGCCAGCGTGTTTGGGAGTATGCTAGAACATTCACAGTTTGGT
GGAGGACTGCCAGTCCCTCAGCAGACGCTCCATACACAGCCTCAGAAGGCTCAAGTCTTCGCGTTCCAAGGCATGGCGCCACAGCAGATGCCGCAGTTca
aacaagaagagcatcaTCAAACACCCAAGGTGGCTGTAAACCAAGCTGTACGTACATCAAGTTGGAGCTGGGATCTGGGATCCTTCTATAAGAGGACTAA
CTGTTCTGTTTCTTTATGTTGAATGTTGTCTATATAGGTCCCGAATGTGCTTCAAAACATGATGAGCCGCAGTGGCACGTCAAAGTTGACGCCTTCCAGT
GTGGAGGCGTCCTTGTTGTCTCTTGTGGACGGCGAGCTCCGCGTTTCCTCGCTGTCGAACCTACCTACATTCCTCAAGATCTTACCACGCTGCAAGACAG
AGCCGGAGCAAACACTAGCACTGGTAGTTCTTCGGGCCACATCTACAGCTAGTGATGCCAAGCTGGCTCGTGGTTGTGCTGGTACCTTTGAAAAGAGCGG
TGGACTGCGCCTTGCACGTGCGTGGGTCGAGACTGCTGTGGCATGGCAACAGAATGATTTGCTGGTTTTACTCTTAGAAGTGCTGCAAACTCTACCGTTA
CAATTAACTAGTATTACGGAAGCACGTATCAATGAGCCTATCGTCAAGTTACGCAAGAATGCTCGTGAGGAGCGTGTCAAGCGTGCTGCTCAGGATCTTC
TCAAATTTTGGCGTGGCAAGTTTactgagaaggagaaaccTACAGCGGCCCCATCAACCACCAAATCCAAGAAAGACCatgcttc