Description :
From Genome Similarity Track
Location :
Scaffold_304:17351- 19083
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_304-snap-gene-0.9SET and MYND domain containing 3
Pytul_var.sporangiiferummaker-pug3_contig_304-snap-gene-0.13Conserved gene of unknown function

Sequence
1732 bases(100 bases per row)
GATGCGGATATTGACGGAATCCCTGAGTCGCAATGGAATGAGTACCGAATGAAGGAGTTTGAGACAGCGGCGGCTCTACTGACCAATCCAATGGTTGCTG
GTAAAAGCAATGATGAAAAGAGGGCAACATTGTTGCGTGCCCTGGAAATCCAGCAGCGCATCTTGCACCCAGAGCATATCAGCATCCTGCAGACATGCTC
GGCTCTCTTCAGTACTGAGATGGAAGATGGCCGAATGGACGAAGCGATTCTCTATGGGGAGCGAATGCTCGAATTTTACCGACGAGTGTACCCAACCAAC
CATCCGCTGACTGGGTTACATTTATTTACACTCGGTGATCTGCATCTTCAGCAGCAAGAGACCCAAGGGAACCCACGTCGAGCAAAGGAGTACTTGGAAG
AAGCCAAGCGGATCTTGCAGATTACTTACGGACGCGCTCACCACTTTGTGGAGTTGCTGAGTCAGCGGATACAAGTATGCTAGAACCAAACGGTAGGTGC
CTTCGGGCCAACTTACAGAACGTCACAGAAACAATTTTGCTGATAAAGGGTCATGATCATGCTCTGGTTGTGAAGTGCGTGAATGCATGACAGAATTGGT
ATTACTACGAAGTATATGAACAATGAACAGAGCTGGGCTCCATTCAAGTTGAATTCGACATCACGTTCTTGGATTAGCTTTATCGGGTGCAATATATTTA
CTGTTGCTGGATCACAATTACTATTCATTGTCTCTTAGGACATCTCTGGTGACGGAACGACAGCATAATTAGTGGTTCTCGTGGACATCCTACATAACGA
TGTCTCCGAATTTTTTATTGCCAACGCATAGCCGCCACAAGTAACAAAAACTCATTGTTTCCATGCACATTTATACTAAACTCACCCACTTCTACACATA
TTATATTTGATCCATTTTCATCTACGTGTAGAATGTCATTGAAGTGTCCGAGTTGGCCGAGAACTCGTCCAGCAGATGCAGATACGATGCGTACTGGCGC
ATCCACTCGCCTGCAATCTTGTCCTGAGCATCGTGGTCGAACAGGTTCAAAAACGCCTTCGTATCCTGTTCGTCAAAGTTGATTTTCATCCAGCCAAGCA
GCTTGGCGACAATCACACCACAACCTTCCTCTTCGCTCAGGTGATGGAACAGGTTACTCAGCGCTTCGTACTCTTGTTCTTCGGTTAGTGATTGCGAGAT
CACATCTTGCACAGCTAGCACCTCCTCACGTAAAACGGCTTCCAGTTCGTTGAAAGTGGCAATGATGGCGTCGCCTAAATAGCGACGATCATCGTGCACC
TTCTCCAAAGCTGTCGCCAGTGTTTCGCTGTAAGCATCGTAGACAGTCGTAACTCTGTACCCAACTCCGGCGATCACTGCGCGCTCTTCAAGAAGATACT
CCTTCAGCGTGATCACATCGTGAACATGTTGGTCAAACAGTGTGAGCCATTTCGCGACAGCAACGAGAGCTTGTGGTGTAGCACTTGCGAGCGCACTACT
GGATACTACAGCACGCACACGACGCATATCTTCTAAGATCGCTTGGTTTAAAATACCAAATCCCACTTCGGACCAAGTACAATTGGCCTCTTTTTGGCCC
CATGGCGCAGCCAACTTGGGAAAATGTTCGTACTCTTCGTCAAACACGCTGTTGCTGTGCTCCGAGTAGCTGTTGTTGCTGCGTGGCGGATCTTCATGCC
GACTATTGTTGCGACTCCGACTCCCAAGCGAA