Description :
From Genome Similarity Track
Location :
Scaffold_391:17351- 18922
Transcript NameFunction/comments
Phyta_totarag7865hypothetical protein

Sequence
1571 bases(100 bases per row)
CGTGGGGGACGGCGTCGCTTTCGTGACTCCGGCATCTTCCGCACCTCCGTCCGCTTCCAGTGTGTCGATTCTGGACGCAGTCTTCATTCATCGCTTCATG
TGGCTGGGCGTGAGCACGACGGACTTTGCCATCTCATTCTACGACATGAGCGAGTCTCGAAAACCCACGTCGACTTTGAGTACGTCTTCATCCGGCACAA
ActtcgcgttgctgcagaatcTCGGCCTCACGACCACTACAGCGCAGATAATGCTGCGGTTTTGCGAGTCgtcggcgttgctggtggGCTCCGGCAACGA
CTGTGTGGTGAACCTTTGGAAAGTGGTGAATGCCGACACGAAGATCCTATGGCGGAGACTCGCACTACACACAGACCTGGTCTTAGACGCTCTGGAGATC
CCAGCGCACGACTTGTTCGTAAGTTGCGATATCCGACACAACATCCAGCTCTGGGATATCACTGACGGCCGCTCTCGTGGTGCTCTCATTGCCCACGAAC
GTGGCGTTCGGCAGCTCTGCTATTCACAGCACCACGACTTGTTGCTCAGTGCCGGCTTCGAGTTTGAGGCGCTCGCTTGGGACTTGGGCTCTCGTCAAGT
AGCTCTCAAGTTATCTGGACATCGAGCCCCACTAATTGGAGTACAGCTTGCGCTCTTCCAGAGTGAACGCGCTATCACAGCTGACTGCCAAGGTGTGTTT
AAAATTTGGGATATCACCCGAGACAACACGAGCTCCACAGCTTCTAGTACTTCCCATGCAGTACAGCTAGAATCGGTCGATTTGGGAATGCCGTCAGTGC
ACGTGGAGCTTATTTCCTTCGTGAGCATGAACCCTTACAGTCGTGATCTCTGGGTCGTTACTTCCGGAAGTTGtacgctgcagcgtcttcgcAGTGTTCG
GGTgcaacagctcgacgagGTGCCGCTCCGCGCGTTTTACCACTACTCAGCGAATAAATTTGTGGTCGTGGCTGGCTCGGTTTGCAGTCTTTGGGACGGA
GAGACCGGGTCTTGCAGTGAAGAGCACGCACACGTAGGCAATCTCGGTATCCAGACTGGTGCTGCGGATACAACGCATGGTGCAGGAAGTCAAAAAGACC
CTGCATCGAGCTCCTCAACTGTGCCGTTGCCTTCTCCATTGACTCCGGCATCCAGACCAACAGCACAACCCAACCGGAACGAGCCAGGAGCAGAGCTACT
GACCTGCGCACACGACTCAAAGTGCAGAAAGTTGGTAGTGATGTCGGAGCAGGGAGCGTTAGCCGTCTTCAATTGCCAGAACTTCATACCGATGCGGCAA
TGCCAGGAATCGTTTCTGTCGAAATCTCGCGTCCAACGGAAAACTTCTGTTGCAAGCAAGACAACACCAGGGATGAGACCTGCTCCATCGTGCGCTGTTG
TGGGTCTGCACTACTGCTCGGACAACAAACTCATCGTCGTGACAGACGCAGGAACGagcgccatcgtcgtcatcgacgacaaTTCGAACCAGGACTCGTC
CAAAGGAATTGGCGTACTGCGTCGGCTTATCAACATCCCCGGCGGTATCACCACAAGCGCATACAGTTTTC