Description :
From Genome Similarity Track
Location :
Scaffold_251:1735- 3043
Transcript NameFunction/comments
Phyag_g3961solute carrier family 2, facilitated glucose transporter, putative

Sequence
1308 bases(100 bases per row)
AGCCCTTCCAGAGCGGTTGGTCCACCTCGCAAACGAACCTGTCACAGTACAACAACACGGACGAGTGCAACGCTCGTCCCGTGGCTGAGGGCACTTGCCT
CATGTTCCCCGGCCACTCGAAGCTCGAGTGGACGTTCGCTGTGAACGCGTGGATCTTCGGCGCCATGATCGGATCGCTGTGCTGCGGCCACTTCAGCGAC
CGTCTCGGCCGTAAGAAGACTTTGATGCTCAACTGCATCTTCATGTTCGTGGGCGGCGTAGTTGAAGCCTCCGTGTCCAACATTTGGGCCTTCGCCGTGG
GCCGTCTCATCGCCGGTCTTGCGTCGGGCACTGCCACCGGTACCATCGGTGCGTACGTGAACgagctgtcgccgccgcaCATGCGTAACACTCTCGGTCT
GGGCCTGCAGATCTTCACGACCATCGGCATCTTGTTCCCGGccatctgcttcttcttcgccaacacgaGCTCTGGCTGGCGCTACCTGGCTGCATTCCCG
TGCATCCTGGCTGTGATCTACATGGCGCTGGCGCCGACCATGTGCATTGAGAGTCCTGCGTGGCTGCTGACCAAGGGCCGCACtgacgaggccaagcagg
tgATCGCTCGTCTGTACGGCGAGGAGCACGTGCAGACTGCTCTGTCGTGGCTCGaagtgaacaagaagcccgAGCAGGCGGAGGAGGGTCTGGCTGCTCC
TAAGACGGAGTCCATGTTTGCTCCTCGCTACCGCATGCAGCTTCTGGGAGGAATTCTGCTGTCgtgcgcgcagcagctttcggGTATTAACGCCGTGTTC
TACTACTCGGGCAACATCTTCTCGGACGCCGGCATCTCGGACTCGCGTGTGGGCACGCTcatcatcgacttcatcaacaTCTGGCCCGCGTTCTTCACGG
GTGTGCTGGCCAACCGTTTCGGCGCTCGCAACATGATCCTGTGGGGTCTGGCCGGCATGTTCGTGATGGCCGTGCTGATGACGGTGGCCTTCATCGTGGA
CGTGTCTGCCCTGTCGATCGTGTTCACGGCCCTGTACGTGATCGCGTTCGGAGTCACGTTGGGTCCTCTAGTGTGGGTGATGACGGCCGACATTTTCCCG
GACTCGATCCgcgccagcgcgtcgtcgctgtgcATCGGCATCAACTGGCTGTGCAACCTCATTGTCGGCGTGGCTTACCCCTACATTTCGGACGCTCTGG
ATGACTACGCGTACGTTCCTTTCGTGGTGCTTCtcgcgatcttcttcttgcttgcTCTGAAGTTGGTGCCGGAGACGACGGGCAAGTCGGCCGAGGAGAT
TCTGGCCG