Description :
From Genome Similarity Track
Location :
Scaffold_39:1735- 2737
Transcript NameFunction/comments
g8275.t1hypothetical protein
g8276.t1hypothetical protein

Sequence
1002 bases(100 bases per row)
TATGGCTTCAGTAGCCCAACGTAAAACGGTGGGTGCAGGCGCATGCTGGACGGTATGTCCAGTGTGTACGCGTTGCCATGCTTCGCCAACACGGTGAATG
GCCCAATGAAGCGCGGACCAAGCAAGCTTGCTCCGAAATCGGAAATTGCATGTTTAGCTAGGTTCTGAGTAGCTAACAGAACTAATGAACACACTTTGAA
TTCATTTGTGTTTCCCCTGCCTGTGTTGTCGGCATTCAGCTTCTGTCGATCGACAGAAGCTGCTATTGCATCTTGGACAAACCGAATTACGGCTTGTCGA
CGCTGGACAAAGTCCATTGCATCCGAGCTGAACCCCTGGTTCAGTTCGTGCTCCTTGTTCGCAGCAGGCACGGCCTGCGCGTGATGTTAGTTGTTGTTTA
AAGTGTCTACGCCCGTCGTAGACACTGTCTTGTCGTCGCCATGACTGCGTGCAGTACGTGCGCGAGTCGTCACAGCTGATACATTGCTTGTATCAGCGTG
CTTATCCGGTTGTTTTGAATTAACCGGATATCCTCCCCCACTTAAGGAAGGCGCTACCGAACCGAGTACGCTCGGTACGCGTGGGTGCCTTATGATATTC
ACGTAGAACGGTGTGTGTCCTGTCGAGACATGCACCGAGTTGTTGATGACGAACTCAGCCATCGGCAAGCGGTCGCTCCCTTGATGGAACGAGTGCGCGT
AGCTCTTCAGGGTGTCAACCAACACGCGGTTGACATGCTCGGTTTGTCCGTTAATCTGTGGGTGATCCGCAGTTGACTTGGCAACTGCGTCCCAAGAAGT
GTAAACACTTCTTGCCAGAATCGCGCTGTAAAGCGCGGATCTCGATCCGACATAATGTCGAATGGCATACCATGGTGTCTAAACACCAGGTCAACAAACA
GACATGCCGTCTGTTTGGCTGTCATCTCGGCTGGTACTGCAGCAAGATGCACCATCTTGCTGAAGCGGTCAACAAAGACCACTATACCAGTCCTCCGCTT
GT