Description :
From Genome Similarity Track
Location :
Scaffold_14:173473- 174954
Transcript NameFunction/comments
g1186.t1hypothetical protein
g1187.t1hypothetical protein

Sequence
1481 bases(100 bases per row)
GCATGACACTTCAAACAGAAGATATCTGCTGCAGGACGACTCGCGTGGACATTCGCGATCTCCCGGGAGCCCTTTCAACCGGCGTCGTCATCGCTACCGA
TCGTCATCGCGATCCCCTGCCCCGAGGAGACGAACGCGCTCTCGCTCTCGCTCGCGATCGTGTCGCCGCTATTGATTCATCCAGTAATTGAACGGCATGG
AGCAGTGCATGTTGCGGTAATTTCTGCTTGGGCTATAGTAGTACATACGAGCGCCATTACAACTCTTCGTCTCGCTCTTTATCTTTTATCCATGCAAGAC
GATGCTGCTATTACCCACTTGCGATATCCATAGGAGTTTGCAACATATACAGCCTTAAACATGTTTCGCAACTATCTATTCAGACTTGGATGTTGTGTGG
GCCTTCTTCTGACGCCCGCAGCGCTCAGAGCTGCCGTCCTTGAGGTCATACGCGGGCAAGTAGTAGCCCTCTTTGCTGTCTTCGCCCTTTCGCCAGAGTT
CTGGGTTCTGCACGGTATCGAAAATGTTTCCTAGCGATGTGTAGCCGTGGTCGTACAGTGAGCAGTACTCCAGTTGGCAGTCGCGCAGGAAGCTCCACAC
ATCCGCGTATGTCCAGCACAAAATCGGGTTCACGCGCAGGAAGGGCGGCCACCCAGGGCTACTCGGCGAGAAGTGCTCCATGTCCTCCGTGTACGGGTCA
CCTCCACGAACACCCATGTACACGCCCTTGATCTTGAGCTTCTCCAAGATGTCCTTCACGCCTTCAACGAACGAGCACTTGTACACGTGACAACTGAGCG
CATACTTCTCGGTGCACTGCTCGGTGAACTCCCGCACCTCCGGGAACTGGTCGTACGAGTCGAAATACATGACTGGCACGCGCTGCAATTGCGCATTCAC
TCGGGTTTCGAGCTCGTCTTCGTGCAGCAAGTCAGCCGAGACGAAACTGTTTCGCGGCGATGTAACAGTCGTCTTGGGGCCGCCCACAGCTTCCTGCTGG
ATCTTGTCGTGTGCCTGCTGCGCCTCCTCCAGTACGCGCTTGCCCACCACAATACGCAGCAGGTGGAGCACCACTGTCGAGTCTTTCCCCCCGTTGAAGC
TGAAGCAGACGCCCTCCAGGCCGAAGATGTCGATGGCGCTGCGAACCACGTCCAACGCCTTCTGCAGTCGCGCTTGCATGGCCGGATCGGCGGCGGCGAA
GAAGAGGTCGAAGCGCAGCAATATAGACCTCATACTAGAGTTGATGGTCATGGTTTTGAGCCCTTAAAGGCGCCGTAAAAGGTGAGGATTACACGGAGTA
GACGAAAGTTTCCCCTGATCTCGGACTTGGTCGGAATTCAGGCGCTTTTGGAGGAGTTATACGGCGATCAATGGCTCAAAAGAAGCGTCGGAAGATGGCC
AATGCGCTACCGGTGATTGTCGAAGTGGAGGATCGATCTGGTGAGCCCTGCGGGCGATGGAACAGAGAGGTGCACCCGCGT