Description :
From Genome Similarity Track
Location :
Scaffold_127:17346- 22402
Transcript NameFunction/comments
Physo_143014reverse transcriptase

Sequence
5056 bases(100 bases per row)
GATCGCCGGCCAAGCACTAATACCCGGTCGATCGAGGACTTGCACATAAGAGATAGATCACTAGAGTAGGTCAAGCTGGCCAATGTATTAATCCAGTCTT
AACCGTATCGCTAGTTCAGTACCCAAAGTGTCGACGCTGCCGAGGCCAATGTAGTTCCTGGAACTTGGTGATTTGATGGGACTTGTGGTCTTCGGTGCAA
ATTCTGCTCTGATTTATGTTTAGCTGGTCTCTCCCTAATGCTACCATCTTGCTTACCCTCCTACAGCCACACGATTACTGGATTCTTGTCCCGACTTCGT
CCTCCATGTGCGTCCCATCCTGGTCTATCCACGATCGGCCCCGATCGGCGATCGACCTCGATCTGCGATCGGCGATCAACTCCCAATCGATGACTTATGC
CGGTTGACATGCGCCGCCGATCCATCACCTTCTGTCCTCGGCCATCCCAGATCCGCGAGTTCTGTCGTCGATCTGGACTTGGGTCGGCTCCGAATCACGC
CGCGGTTCGGGCACGATCACCCACAATCCGGCTTGCCACATGTCCTGCCTCACGCGCCGGCGTCATCGGACCACCTGAGATCTCCCGAAGAACTCCTTCT
GATCCGTAGATCCTTGCTGCCTGTCTCTCGATCGCCGAACTCCCACGCCTCCAGTCGATCGGCCCTGCCGCCTTTCTCGGAGAACAATTCTTATTCAGCA
CTTCTCCACACGAACGTCTTCTCGCGTCCGAGGTGGCCGCCGCTCGGCGTGTCATGGAACTCGTGGATCAGCCGAGCTCGGAGATCGTCGTCCAGAGGAA
CGACGATGCGCGGGGGATCTTCACGGTCGACGCGGTACGTGAGCAACTCGACGTCCAGCGAGTAGCGGTCGACGCCGGAGCGGCTGCGTGAGACAGCTGC
GCTTCGCCCCGGCACCAGGGTCTCGCAGGAACTGGATCAGCTCCAAGCAGGACGCGTCCTCCTGNTACGCGTCCACGATCAAGTCACGGAGCGGACTGGT
CGCTGCAACCTCAACAGCAGCGACGTCTTCGGCAGTGCATACGGCGCATTCGTCGTCGTCCTCGTCACCAACTGTGTGGCGACCTGACTGCACGTAGTCA
GGCCGACGCGATAACGCGTCGGCAAGGATGTTGGTCTTGCCCGGCTTGTAGTGCACGACGAAGTTGTACTCGGAGAACAGGGACAACCAGCGCGCCATGC
GCTGGGACAAGTGAGGGCTCTTCGTCGCTGTCCTCAACGACGCGTGATCGGTGTAGATCGCGAAAGTCTGTTCGCCGAGGAGATACACGCGGAACTTGAT
GAGGGCGTAGCGCATGGCCAGCAGCTCCTTATCATGGACCGGATAATTCCGTTCCGCCGGCTTCAGCTGACGCGACCGGTAGCTGATGACCCGCTCGCGT
CCTTCGTCATCGAACAGCATCAAGGCGCATCCGATCGCGAAGTCGCTCGCGTCGCACACGACATGGAAGGGCTTCGAGTGGTCTGGAAGCATGAGCACAG
GCGCGGTGGCCAAGTTCGACTTCACCGCGTCGAAGGCAGCTTGGTGCTCGAGACGCCACGACCACGTGGCGTCTGCCTTGAGGAGTTGAGATAGCGGGCG
GATCGTCGAAGCGAAGTTCGTCGAGTAATGGTGAAGATACGTGGCGAGCCCCAGCCACTGCCGGAGCTGCTTCTGGTCCTGCGGCGTCGGCCACGCGCAG
ATTGCCTCGATCTTCTCGGGGTCGGCGCGGACACCGTCCTTGCTGACGTAGCTCCCGAGCACAGGGATCTCGGGAGCGCAGAAGATGCACTTCTTCAAGT
TGGCGTACAGCTTGTTCTCCTTCATCACCTCGAACACCTTGCGCAGGTGTTGTAGGTGGATCTCAACGTCCGTCATGCCGTCCTCGGCACGACTGTGAAT
GAAGATGTCGTCGAAGTAGCTGGGCGCGAAGTCTCGGTACGGCCGAAGCAAGTTGGACACCATCCGATTGAAGGTGGCGGGGGCGTTCTTGAGCCCCTGC
GGCATCACGAGCCATTTCCACAACATCCCGCTGGGCGTGCTGACCGCTGTTAGCAGCACATCGTCTTCGCGCATCAAGATCTGATAGAAGCTATCCATCA
GATCAATGGCACTGTACTTCGTGCTGCCAGACATGGTGTCCAGCACCATGTCCTTCCTCGGGATCAGCGTTTGCGCCGGTATGGTGGCCTCGTTGAGCTT
GTTGAAGGCGTGGACGATTCTCCAGCCGCCGGTTGGTTTCTTCACGCAGAACGTCGGACTGGAGTGCGGCGAGAGACTCTCGCGAATGTGGCCGGCTTGC
CGGCGACTCTCGAAGAAGGCGTCAATGGCTTCGACTTGGTCGCGAGGAAGCGGCCACTGCCGCGTCACACAGTACTTCGCACCGGGCACGAGGTCAATCT
CGTGCCGAACACCGCGGTCGGGTGGAAGAACGGCTGGAACCTTGTCCGGGAAAATCTCCATGAACTCGCGCACGAGCGGAGCGACTGGGTTGCCGGCCGC
TTCGAACGCCGGCAACGACTGAGCTGCGTAGCGGGCTTGACGGGCGTTCTTAAGCTCGCCTCCTTTTGGGCGCGTCCTGGCGTCGGAAGCTGGGTCCGAC
GCACTGGTTGCGACGGCCGCAATTGACTCGGCGTCTTCAGCGACGATCATGCACACCTGCTCGATCTCGCCCTTCTTCAGGTCACGGAGGAAGTGTTTCC
ACGAGAGCCCAGGCAGCCGAGTGATCTCGGCGGCGTCGCACGGTGGACGTGCGACTTCGACGTCGCGTACACGCGGAGGCGCCTCCGCGTCGTCCCCCAC
CAGGAATGAGATCACTTCAGCCTCAGCCTCAACTGAGTCCGCCGAAGGCGTACGAGGATGGCGCAGGTTGCGACGTTCGCGACGTCGAATCGGACGTGGA
GTGTTGTCCGAAGCTGCCGATGAGAGCCCATGCTCGATCACGGCCGCTGAACTGGGGCGCCGGGACACAACGTCGGCGCCTGGACGCGGGTCATTGGACA
CGACCGCGTCGACTTCATCAGGGAGCTCCCGCTCGACCACTCGCGGGAACCCATGCTCGACCGCGTGTGGGAGGCCACGCTCAACCACATCTTCTCGTAC
TTCAGCTTTGAAGAGCCGCTGCTCGTCCTGACGTGGTTCGACCACGTCATTGTCTGCTTCCGAGAACCGCTGCTCATCGGGACGTGGGAACCCATGCTCG
ACCACGTCAGACACGTCCTGAGGCTCCTGCTCAGGACCGGCGCAGGTTGCGAGTTCGCACACCGCACACGAAGGGCCATCACTCGCTTCGTGCGCAGCAT
GGGTCATTGAGTCGGGGTCCATGACGGCAACATGCGGCCACTGGTTAGGCGTTCCGCACAGAAACGCAAATACTGCATTGACATCAATGTCTCGGAGGCG
GACTGTGCCAGTCAGCCAGTTGATCTCAGGCTGGTGGCGAGCGAGCCACGGGATGCCGAAGACACAGTCGAACGAGCCGCTCAGCTCGATCACCAAGAAC
TCCTCGGAACTGCGGAACCCGTCGAACTCGTACGCGAAGGTCACCGAGCGCCGCGGCGTCCGCCGTGGCTTCCCACCAGCGTACTTCACGATCATGTCGC
CAGGCCCGTCGCGAATGTTCAAGTCCGCCGGTAACACCGACAAGCTCTCGGCGCGAACGAAGTTGTTCGTTGCGCCCGAGTCCAGCAGCGCGCGAAGAGG
GCGCGTCGCGCCGTCAACATGGAGACTAAGCACAATCAGCCTCGTGTCACTGCCGGAGGTGGTGGCAAAGAGTTGTGCATGAAGCACGGGAGGGCTAGGA
GGAGGTTCTGCCACCAGAGAACCATCTCTCCTTCCACAACCAGTAGAGCGCCCCGCACCTACTGGTTGTCGCCGTTTTTTTGGAGCGGTGACGTCGTTCG
CGACCGTGACGTTCGCCTGCATCGGCGCCGGAGCGCGGCAAATAGCCGCGCGATGTCCAGGTTTCCCACAGCGGCAGCAGCGCATCGGGCGGGGACTGCA
CGTTGACGAGGCCGTTGGCGGCCTTGCTGATGATGTCGGCACCCGACGTCCACCGAACTGTTGAATCGCATCCACCTCCATCGGCTCCGGCTCGGGCACC
GGGGCCCGAGAGACATCGAAAGCCTGCGACGCCGTCACACCGTAGTCTTCACGGAGCCCAACAGCGAAGGCCTCTTCGAGTGTCGGTGGGGTCTTCCGGG
TCAGGTAGAAGCGCTGGTAGCCAGCGCTCATGCCGGAGATGAAGACGTGGACTTGGGTCGCCATGTCTACGGGATGCGTTGTGATGCACGACACAAGGTG
TCCTGCGCGCTGGATGTACTCGAACATGGACATGCGGCCTTGCTTCAATGCCAGGAAGGCGGAGCGCTGAACGCTTTCATCTTGGGGCGGCTCGAACGCG
AGTCGCAAGTCCGCCTTCGTCGATGCCATGGTCGGGAAGCAGGAAGCGTCGGCCACGAGCTTGCCGAGCGCCCACTCCTTCGCCTTACCCGCCAGCTTGG
ACAGGAGAAAGCGCGTGCGCGCGAGCTCGGTAGACAGCTGCCGAGCTTCGATCGCGATGTCCACCTCGCAGAACCAGCGGTTCAGGTGAAGGCGGCCCTC
GCCTTCACCGCTGTACGTGGAGACATCGAGCTTCACGATATCGGACTTGTTCTTGGTCTGCGTGGGAGTCGACACTCGCTGACGGAGGTCAGCGAGTTCA
CGCGCCATGAACTCCTGGGCGGCCAGACGTTGTTGTTCCTCGGTTCCTGCCGTCAGCAGTGTCTTGATCACAGCGTCACCAGACACCGCTGCGAGGAGGT
GTAGCGCCTCCCACTCGGTCGCCGACAGGTGCGGAAAGCTGGCGTGCTCGAGTGAAGTGGCAGTCGTCCGGGACGCGTCAGGCATCGACGTGTCGTTATG
ATCATCACGATCTTGGGCGTTGGACGGATTAGCGAAGCGCTACCAGGTGTAACGGGCTAACTGCAGCCCGTTACGTGCTTACACAAGTAGAGGAAGTAGT
AGGCAAATTGAACTCTGATTGATTAATTGACACGGCGTAACCGCCGTGTCCACTTA