Description :
From Genome Similarity Track
Location :
Scaffold_151:17346- 18732
Transcript NameFunction/comments
Phymu_g5579hypothetical protein

Sequence
1386 bases(100 bases per row)
GCCTGcacggagctgcttgatgatAGCTTTCAGACGGTTCACCTGCTCACTTTCCGAGTTTTTGTTAGCGTTGTTCGTGATGAGCTTCACTCGCGACGCG
TACGTAAGCGACGTCACCGTTTCTTCCTAGGAAAATGAGCAAGCAAGAAATTAGTGAGCTGTAGCCATTCCAGGTAAAGCCCACGGTGTCCTGCACCTGG
TTGTAGTCGGCTGGCGAGATGTTGACGAACATAAGCTACAAGATGCAGTAGAATCAGTGAATATAAACCATTATTTTACACGGAAGTTGGTTGGGAACTC
ACCGTCTTGGCGTTTCCTCCGAGCGAGTCTTGCATCAATTGAGTCAACTAAAATCAAGATCATATTTTAGTCCTCTCTTCCGTTTCAGACAGATTTCAGA
TCCCGTTACCTTGTTATTCCGATACGGAATGAACTTCTCGTTGGTTGACAGCGCCGAAATGACGTCTCCTAACGCTACAAACACTCCAAAAACCCACATC
AGTACACAAGCAGACCCCCTTGTGCACTGTAATACACGCACCACTTAGACTCTTGTTAATCGCTTGGGCCTCTTTCAGTCGATCGGCTGTAGCTCCAGTC
TTCCCAGCCCTTTCAGACCCAGCCAAATCCACGAGACTCAACTTCCCAACGGTAGTGGCCTTTGTCGTTTTATTGTAACTCTCTACCAGCAGAGAGAAGA
CGGAGTGACTGCGACTGCTTTCCGCGTTCATCTTGGTGGCCCCCACCTgtcgcttcttgttggcagcttcaaagagcttcaacgtctGCTCAGGCGACGT
GCATTTCTTCAGTGTGGCGTTCTGAACGACCACCATTCCTTTCTCGTTCTTCTTAATCTCCAGTTTAGTATCATGCGCGCCTCCGCCTTCCATCAAGTGG
AATAAATCAATCAGCGAATCGTTATACAGCTCCAACATCGTAGCTTGGAAGTTCACTGTGAAATTGGCTTTCCCTTCCTCCGCCAATTGGAAAAGATGGT
GAATAGCTCGAGGACTCAGACCCGGATCCTTCTCACTCCCAGTCATAGTAAAGGTTTTGCCCGATCCAGTCTGCCCATAGGCGAAAATACAGACGTTATA
GCCATCCACAGCGCTCTGAAGGAGGTTCTTGGTATCCTCGAACACCTGAGGCTGCGTACTGGCAGGAGAGAAGACCTGGTCGTAGGCGAAAGTCTTCACT
GCTCGGTTACCGCCGCTCACTTCGAGCGagaactcgtccacgaacttgacgCACGTCACACAGCCGCGATCGTTCTCTGAGTTGCTCATGGGGCGACAGC
GGGCGTAGACGCGGATCTTCCCCTTCATATCTTCGATCTGGTTGTAGTATTTCTTCCTCagcgcttgctcttctttgtagctcgtc