Description :
From Genome Similarity Track
Location :
Scaffold_96:17341- 19110
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_96-fgenesh-gene-0.7SAP domain containing protein

Sequence
1769 bases(100 bases per row)
TCAGCCAATCATAGAGCACCACGAGATCTCTGCTTCCTGAATCTGGCCACCGGCTGTGGGATCGTGCGCGTCGCTTGATCGTCCACAATGAAGATCCCCA
CGACAGAGAACAAGAAATGGCGGGCTCTCCACTGCTCTGGTAGTGTTCTACGACCATACTTATTGCTGGCGAGAGAACTGTTCTCTCTCGCAAACGCGAT
ATAAAGAACATTCCGGGCGTCACTGGTTGCAACTTTGGGCGGTATAAATTACACAGTGGTTATATTGGTTACCCTCGCGGAGGGGTTGGCCCCATTGACT
TCTGTAATGGGAATGCGACGATGGCAAAGCTGAAGGACGCGACGGGACGGCATGCTGGCATTGGCGACTAGAGCCGCCATGCGAAAGACAACGACGACAC
GACAACGGGCTCGTCGAGACGCGACGGTACGCTACGAAGGGGCGACCTTGCCGCGTCTCGTGTTTGGTCCGGTGCCCAATGGCCCACTCCCTGCCGCTCG
TCATTCATCCCATCTCGACAGTGTCGCTTTGCGTCGTGCATTGTTGACTGCTTCTACTTGGATGCGTTGAAGCGGTCAAGGCGCCGACGCTTCTTCTCTT
CCACCTACAGATGCATTAGAAATATGTGAGCGAAGTGACCCCAGGATCTCCAAGACCCACGGCTTACAATCTCTGCCGTCTCGAGTCCGAACCGCTTTGC
GCGCTCGAGACGCTTCTTAGACTCGGCGTTCAGGCCGAAGCGGTCGGCGCGAGCAGCCTTCTTCTCATCCAACTACGAGAGCACATTTCCACACTGTTAC
ATCTCGCCGCCTGCCACGCCATCTTCCACTGTTAAATTAGACTCACCGTCTCGGGGGTCTCGAGCCCAAACCGCTTGGCCCGTTCGAGTTTCTTTTCCTT
CACTTCCTCATCGGCCTTGACCGGCAGATTGAAGCGCTTGGCGCGCTCGGCCTTCTTGTCCTCGAGCGAGAGCGGAATGCCAAACTTCTCGGCACGCGCT
TTCCGCTTCTCTTCCTCCGACACCCCTTGGGGCGCCACTGGCGTGTTTTCCTTGTTCACTGGTGCCACCACCGATGCAGCAGCAGCGTTGGCCACTGCCG
GCTTGGCGACAGTCGTTGCCGCCTTTTCGACCGGCGCCTTCGGGGACACTGGCTTGGCCGTGACCTTGGGCTTGGTTGCCTCCGCTGGAGCCGTCTTGAC
GGGCACCGCCTTCTTCGGGCTTGCTGGAGTACTTTCTCCATTCGCGTGGTCGTCCGTGGGTGGCGCGAGATCCTCGGCAGCGCTGCCAAACTCCTCTTCG
TCGAGCGCCATTTCGAGACGCTGGATGAGCTCCGACTTGAGGCCATTGGAGCTCAGTCCGCGCGCCTCCAGCTCTGCGCGCAGCTCGCTCACCTTCATCT
TCTTGGGGACGATCGCCGTCATAGTTAATCAGGTCGCGCGGTCGTGGGGAAATCGATCACTCGCTGGTTCGCTGGGCGGGCACGAGGGGCTTTTTGTGTC
TCCCCTTGGGCAGAATCCCCGCCACTTTATAGAAGTCCTGTGCTGGAAGGTAAGAAACCTCTGTTATCTGCTATGGATATTTAGCGTATTTTTCAAGAAT
GAGAGGATTGTGGTTACGGTATCCGCATATTGGATTTAACCTAATGCAGTTAGTAGCGTTTCGGCGCTGTGAACTCCTTGGTCCACTTGGCCATGTCGAT
CGGGTGAGTGTCCTCACTTGCTTCATCGTCTTCAGCCCAGATCTTGATCGTCTTGTCGGCCTCGCACGT