Description :
From Genome Similarity Track
Location :
scaffold_46:173339- 175911
Transcript NameFunction/comments
Plaha_PHALS_09920Protease inhibitor protein
Plaha_PHALS_09921h-or na-translocating f-v-type and a-type atpase (f-atpase) superfamily

Sequence
2572 bases(100 bases per row)
TACTTTGAGAGCCTTCTTCGTACAAGCCACCCGTGCCGCTGTAGGCATCCGAAGAATCGATTAATGACTTTGTAGTGCTACCGTCGAACGTTGTGGAGCT
TTCAACCGCATTATCTTCGTTGTTAGATGCACTATCGTCAAGCGATACCCCAAACAAATGACCATAGAGCCTTTTGTATTCTGCCAATATGCCCAGATTG
TGATTTGTGTCCTTACACTTGGTCATTCGCAAATAACACTCATTCGTGTATGTTTTCCCACTCTCGTCGCTCACAGGGTCGTATATGTCGGGGCATGCGT
CAGGACAGGTTTCAGTTGTGCTGCCTGACTTCGATAACTCGTCAGATAATGCTTCGGACCCTTCAGCGCACTCACCAACCGCCAGCAGACTTAGCGTGGC
TGTTCTGCATTGGGCAATGCTAAATGCACAGGCATTTGTATACGTCACGCCGTCAGAACCGCAAACGGGTTTAAAGTCGGTAGAACAAATCGTGTAACAA
TCATCATCACTCCCAGAGGCATCGGACGAGCATGAGACGTCCCAGTAGTCGCTGCTAGACATGTCCCTTTCGTCACTGCCAAAGACCTTGCTCGAGGTTA
AAGAGTCTGTGCCGTCAATTCTAGAGGTTTCAATCCAGGACGAGGCGTCCGTATCATCACTCTCATAGTCTTCAGAAAATGAAAAGTGCGTATTATGTTT
CAGAGAGTCCGCGGTCAAAGATGTGTATTTGTCGCTAGAGGCCTCAGTCGACGATGAGCTGTCCGTGTATTTGCTGCCAGAGGCTTCAGTCGAGAATAAC
GAACCCGAGTATCCACCTTTTGCAGCATCACTTAAGTATGCGGACTTTTGGTAGACGCTTCGAGAGACTTCGGTCAAGCCTGAGTCATCGTCCCGAAACA
TTTGGCCTTCTGGTTCCAATTCCGCCATTGAACCCACGGTCGAGTCTTTGGTGCCCTTAAGATAATTGCTCGCATAAACACAGCTGAGCGCATTCGCCGC
AGAGACGATGATGATCAACCACTTCATTGAGGTGCGGAGAGGAGGAATTGGACAGTACTTGAGCGGAGAAAATACCTACCGCTATCCCCGAAAACAGATG
GCATTGTTGCAACGTGGTACTGCAATGCATTGGGACTAATTTGTGCTACAGTATATTTCTTATCGTTGGACCTATTTCATGTGAAGGGATTCCACTAAAT
GCTTGTATTTCTTTATGGCTCTGCTGTAAAAAACGTAGGCCGTGGCAACATCTACGAGATGGTGTGTTATTCCAGTACGACTTAACAAAGTGCAGCCGAC
TTGGTGTAGTACTGATGAGAATTAGGCTAATGAATTTGACGTTGGCAAGACAACGAAATACCTCAAAGATGCAATCTATAACGCCGGTACCGCGGTGCGT
GTCGTGCTCCTTAGCACCCATGAAGGGAGGAGGCGTTACTGGGCTTTTTAAGTGCTGATATAAGGATAGAGGGGCATTATATCCTTGTTAACTTTGGAAG
AGTGCATTACCGAATACATCGCGGTTCGAAGATTTAAAGTTGTTAGTGCTTGTTCCTCTTTTGAGTCTCGTTGGTAATGCTTAAAACTGCCGCTAGACCG
CCCTCTAAAAAGAAAATACCGCAGGAATCTGATGAATTTCGGGGCCGTACACTTTGTCATTGGATAGTCGGGCTACCCAATTACGATTTAGCCACCAACC
AGTTTAATCGACTTTGCGATGTGCGAAGAAACACTCTTAGCAAAGCGTGTTGGTAATAAAGGTTACTGAACAGTGGGTTATTAAGAACGATTGAAGATAA
TCATGTGCATTGGCTCTTTGAGAATAACCTGCACGAGCTGATTAATGCCTTGCTCATGGCGTCTCAATAAAGAATTGCTTACGCCTAAAGCGATACGCTT
ATTATTACCTGAAAGTATGGCCGTTCATCGCCTAAGCCTTCATGAGTAAAAAACGCATTTTTCTATACCTTCGCCTTGAACACCTATTTAATTGGTGCTA
AGCGGCTGGAACGAGTTTGTGACGTAAGGGTAGTACTCAACCTGCGATGATCCTGAAGAACCATCTTCGAGACCTGAGAATTGTGCTGGCTGCAAATGTG
CATACTTCTTCGCCAAAAGTGCCCGTAACTTTTTATCTTTACCTGGACGTGGCTTCCAAATAGGATACACAGAAATTATATGTTAGTCTCGCAAATCGTC
ATGAGGTATGCTGAACAAAGGCAAGCCGCGACGTACTTTATACATAGCAACGACAAAATTCACCGGTAGTCCATACCTAAGCACTGACTCCACAAAAATG
CGAATCATCTAAACGCAAATTTATGCATTTCGATAACTcagacatcattgtgtgaaaACTTAGTAAATTTTTTACGCACCTTAATATGCATCCACGCAAT
AAATGTCTCTCCAAAATGCGCCTTGCACCAACGAATAAGAGCCGAATACAATCGGTCAACCTCCAATTTGAGCTCAGCAATCGCTTCTTCGTTCGAAGCG
TGACTCATCGGATCAAAAGTGAAGTCACGAACGATAAAGCGCTTATCTTTAGCGCGTGCCTTAAAATCTTCT