Description :
From Genome Similarity Track
Location :
Scaffold_17:1733- 5186
Transcript NameFunction/comments
Phyin_T30-4PITG_098074-hydroxyphenylpyruvate dioxygenase

Sequence
3453 bases(100 bases per row)
AACGGTGGTGTGGGTGTGGTGGAACCCCAGACACTGACTGACAAAGAGTCGGGCAAGACGACAACCGTGTCGGAAGTGAAGCTGTACGGCGACGTGGTGA
TCCGCTGGGTGAGTGGGGACTTTGAGGGTCCGTTCGTGCCTGGCTACGAGAAGTGCGAATGCCCCGATGTGAGCATCGGTATCCAGCGTCTGGACCACTG
CGTGGGCAACGTGCCCAAGCTGCTGGAGGCGGTCAAGTACATCACTGGCTTTACCGGTTTCCACGAGTTCGCCGAGTTCACGGCGGAAGATGTGGGTACG
CTGGACTCGGGACTTAACAGTATGGTCCTGGCCAGTAATAACGAGATGGTGCTACTGCCCGTAAACGAGCCAACTTTTGGCACGAAGCGTAAGAGTCAGA
TCCAGACGTACCTAGAGCAGAACGTGGGTGCGGGTCTGCAGCACATGGCGCTTAAGACGGACGACATTTTCCACACATTAGCGGAGATGCAGAAGCGCAG
CCACGTAGGAGGCTTCGAGTTCATGCCCCGACCTAACAAGGTTTACTACGAGCAGATGCCAAAGCGTATTGGAGACGCTTTGACCCAGGAACAGTACAAG
CAGATCGAGCAGTTGGGTTTGCTGTTGACAAGGACGAGCAAGGTATTTCGCTGACAGATTCTTCCACCCAGACCTTGGGGGAATGCTGCCCACCTTCTTT
TTTCGAGTTCCTGCGAGCGCTGGGGGTTACCAGAAAGAACTTGGCGGTTTCTTTGAGAAACAAAATTGCCGTTTGGCGGAGAGTTTGGGTTAAAGGGCCA
ATTTTTGGGCTCTTTTTTCAAAAAAATCGATCGAGGACTATGAGAAATCGTTGAACGTGTGAGAGGCTGACTATTGCAGCTCTTGAGTTGACAAAGAATC
AAACGATCTCTTTTTTTATGCGTAGGGTGTTCCTGCCTTACTATAATACTATATAATACTACAGTACAACGTTGCCTTGGATACAATCTGAATAAATGAC
GGATAGATTACCGATGGGAATTCCAATCCGTAGTTCCAGTCCAGCATGCATTTCATCACATCCTTTCGACCAGAACGGAAGTGACAGGTATCGAAGACAA
GTCGATGAACTTCAACTTGCGTTCCTCTCTCAATTTGGCTCGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN