Description :
From Genome Similarity Track
Location :
Scaffold_82:173262- 179401
Transcript NameFunction/comments
Sapdi_VS20SDRG_15005hypothetical protein
Sapdi_VS20SDRG_15006succinate-semialdehyde dehydrogenase

Sequence
6139 bases(100 bases per row)
GGCGCATGCGGTCGTTCGTGCAGAACTTTTTGGCCGACGACATGGGCACGTTTCGCAGCGACATCGACTTGCACAAGCACGCTGTCGACACGGGCCGTGC
CGTCACGGACGCCGACGTGCAGGAGGTGGCGCGTATGCTGCCAGGTCTCAAGACGCTTCGGCTCTCGCACTGCGTCGACGTCTCGGATGCGTGCTTGTGG
TACTACAATCGTACGCTGTCAACGGTATGTCGTTGAGCGCTAGCGTAGGGCGGTTGCCAAGCACTGTCCGTCGCTTACGGGCATCTACATGAGCCAATGC
GAGCGCATCACCGACCTCGGTCTGCGCGTGCTCGCCCACAACTGCAAACTCGTGACCGTGGATCTGAGTGACTGCAAGCAGCTCGGTGACCTCGCGCTTG
CAACGCTGGCCGCGGGCTGCTGGATGATCGAGACGTTCATTCTCGCGCGCTGCCCGCATGTGACGGACGTCGGCATCGCCAAGATTGCGCAGTGCTGCAA
AGGCCTCACGTACATCGACGTCTCCGAGTGCCAGCACGTCGGCGAGTTTGGTGACAAGGCGCTCCTCGAGCTCGGCAAGTGGTGCGGGAACCTCAAGCAT
TTAGACCTCTTTGGCTGTCGGCACGTCCGCGACATGGGCATCCGCGCGATCGCAAACGGCTGCCCGCGCCTCTCGACGCTCAAGCTCACGGGCTGTCGCG
ACGTGAGCAGCATCTCGATCCAGGAGCTTGCTTCCAAGTGCCACGCGCTCATGCGGCTCTCGCTCGCTGGCTGCGTCAAAACGCGCAACGAAGATCTGGT
CTTGCTCGCCGCCTCATGCAAGGAGCTCGTTTGGCTCGACATTAGCGGGAGCCCAAATCTCTCGAACCGAGGCATCGCAGCGCTCGCGCAGCACTGCACG
TCGCTGACGCACCTCAATCTCTCCGACTGCCAGCACGTCAACGACAAGGTACTCATTACTCGTTGAATATGAAAAGGGCTTTGAAGAAGTGTGTTAGGTG
CTGCGGACGCTCGGCGATCACTTGCGGTCGCTCACGTCACTGTCCCTTGTCAACTGCGGTCGCATCACCGAGGCCGGCATCGACGCCATCACGACCCAAT
GTACCAAGCTGTTTACACTCAACATGACCGAGTGCCCTCACATTCGTCGCCGCTACCTCCACGAGGTGCATCGTCGCCATGTTCGTATCTCATGAGCAGA
GTAGCTCGTCGCGCGCCTCGAGTTTGTCGACTGGTCGAGCGCCTTCTTTGGCATTGAGCCGCTGCCCAACGCCATGGACCTCCAGCTGCGCGTATGTCAA
ATTGTCTTCGTTTTCAGTGTTTTTGAGAAAATGCCATAGAAAGAGCGTCGGATTCTCGAGCGCCAAAGCGCGATCCAGATCCAAGCTGTCATGCGAGGGT
GCCTCGCGCGCGGCGGTGTCTACGGCGCCAAGCTCCGGCGCGTCGAGCGCACGACGTTGCCCAAGATCCAGGCGCGCATCCGGGGATGGCTTGCCCGCAG
CGCGTACCGCCAACTGCTTCTCGCCCGCCTCCAGCTCGTCATGGCTCAGATCATTCAACGCGCCTATCGCCAGTGCCTCGTGCGGCGCATGTGTCGGCGT
GCGCGGCGGCTTTTGCGCATTCGCAACAGCCAAGAAGCGGCCGCCATCATCTTTCAAAAAGTACATTTTGGTCGTTCGTGCATTGACAAAGACAGTTTTC
GCGTAGATGTATCGCGGGCACAAGGGACGCAAGCGTGTTGCACAGATGCGCGCGCGCAAGGCCGCCCATGCCCAGCTCGAGGCGCGGCGCGCGGTGCTTT
TTGAACTCGCAGCCATCAAAGTCCAGCAAATGTACCGCGGGCACAAAGGCCGCGGCGACTGTCTCCTCTTACGTCAGATGCGCGAGTCCGCGCGGCTGCA
GCGCGAGAAGGAGCGGGTCGCAGCGGCGATGCTCCAGCGCATCTACCGCGGCCACCGCGGACGAAAAGCATACCAGCTGCGCCTGCTCCAGCTGCAAGAG
CTCCAAAACCAGCACGCCAAAGCGACTACCATGCAAGCTTCGTACCGCCGCTTCCAGACGCGCCAGCAGGCCAAGATCGCTGCCGCCCAAGACGCCGAAG
CCGCCAAGCTTCGCGCGATCGTGTGCATCCAAAAGCACTGGCGCGGCACGCGTGAAAAGCACTTGGGCGCCATTATGCTCGGGCTTGTGTATCTGCGTCG
ACGCGAGCACGAGGCCGCGCGCGTGATTCAGAGCCGATGCCGCGCGTTCCTCACGCGGGGGCTGCTCCGCGCGATGAAGGAGGTGCTCCGGCTCAAACTC
TCGCGCGAACGTGGCGCGACAACGATCCAGCGTGTGTTTCGGGGGCATAAAGGACGCGAAGCCCATGACGTGCAAATCGAACTGCGCAAGCTCGAAGGCC
AGGCCAAGCCTTTGTACGTTCGCATCGCCAAGTTTGAAAAGGCGGTTGTCGGGCTCAAAACATCGGTCGAGACGCTTTCGTCAGCGCTGGCGGCCGACCA
AGCCGACGAGGTACGTTGCTTGTCTCGCCCACGAGAGCTCGATGTCCTTGGTCGTAGGCTGCGATCGCAAGTGAGCTCGAGAAGACCATGACGATCAAAT
CGAAATTTCACGACTCGGCGCGGATCACGGGGGCCAAGCAGCGGTACCTTACCCGGTACCTCCAAGCGCAGCTCGCGGACCAGCTCCAGAAGAAGCGCAT
GCTCGTCGCGGTCGAGAGCCGCAACCTCGAGCTCGCGGTCGCCGAGCTCAATGAAAGCGAGAAGCAGCTGCGCTTCGCCAAGCGCGAGCTACAGCCGCTC
ACCGAAGGCGTCGAGCGCAAGACCAAGGCGAGTCGCGTGAGTCGCCTCCAGCACCAAGTGCGTGCGCAGCGCGGAGGTGCGATTGCGCTGCAGCGGCTCT
TTCGCGGGTACCGCGTCCGCGCGGCCGTTGCCGAAGGTTCAAACCGCTGGATCGAGCTCTACGATCCGGTACTCGAGCGGCTCTACTACGTCAACGCGTG
GAGCCAGGAGACGCGGCGTGTGCGGCCGCTCGCAATGGGCATCTTTGGCGACAGCTTTGTGCCACCGTACAAGGGCACGTCGTGGTACCAGTGCCGCGAC
GAGACAACCCACGCGTTCTACTACTTCAACCGCGAGACGCACGAGTACCGGTGGGAGCCACCGGAGGCAACGACGAGCGCCCGCGACGTCTTTGAAGCCC
AAAAGAAAGACGAGTTGACGCAGCGAGCTATTCGAACGCGGCGCATCGGCGCCTGGGAAGAGCATGTGGATCCAGTGTCCAACTCGACGTACTACTACCA
CCCCGAGACAGGCGAGTCGACATGGACGCTGCCACCGACACGAGCGCACTCGGGCCGCGTCTCGACCGGGCGGCGGTCGGTACATAGCCTCGAGCGCGCC
GACGTGCCGATACAGTGGCAGTACTACTACGGTTACGACGTGGATGACGAGAGTAGGCGGCTCGTGAAGCGATCGTCGCCGCGGTCGCCGTGGACCGAGT
GCTTTGACGAGTCGTACCAGCTACCGTACTACTACAATCAGCTCACGACTGAGTGCCGATGGACAAAGCCCGACGACTTTGACGTGCCTGTGACACAAGC
GTCGCCGTCGCAAGGCCTTGAGTGGTTCAACGAACAGACCGAGAAGAATACGCTCTCGGCGCGGCGGTTTACAAAGACGCGCGACATTGGCTCGATCTGG
GAAGAGCACGCGGACGCTGAGACCGGCGTTGTCTACTACTTTAACACGATCACGGGCGAGACGCGCTGGTCGCTCACGCCGCGCAGCTCCCGCGACGACG
AGGCCGCGGCGAACCGCATGCCGTTGACGTTAAAGGCCAAGCTGGACGCCGCCAATGAGAAAGGACCGGTCGCGTACGCTGGCCGCGATGTGCATGCAGC
GTGGCTGGCAGACGCGGTCGAGGCCAAAGAGTGGGCCAAAGCCGACGGCCTCGTCGAAGAAATGCGGTGGCGCGAGGTGGAAGCTGAGGCCAACCCTACC
CCGCCCGACGAGGTTGGCACGACGCCCGAGTGGCAGCCCATGGAAGAGAACGGCGCTGTGTTTTGGTACAACACACGCACGGGCGAGTCAACGTGGGATC
CACCCACACGTGATGGGCTCGAATAACTCGAATAACGTTATAGTCCTTTGAGTTTTAAATGCTTAATGGATCTCGCGCCAACATTTTTTGATTGCCAGAG
CTTGCGACGTACAGCGCTGTCCGCGTCAGTTGGGGTTCTAAGTTAAGGCTAGCGCTCCGCCTCTTCTCGCCGCAAAGCTCAACACAGCGCCTCCGTGCAT
TAGGTACCACCAAAAACGTAGTAAACAAAGGATCAACCGCGAAGCAACACCGGTTTAACACTTTAGACATGAATATGAACACTGGACTTCTATTGTAGTT
AGTAGGTTGTCTATGCGAGGCCGCCCATGCAGACGTACTTGAGTTCCGTGTAGTCGTCCTACATAAATCGCGATCATCAGAGACCATTCCAATTCCAAGA
CACGAGTTCGTACCATGCCGATGATCGAGCCTTCGCGGCCGAGGCCCGACTGCTTGATGCCGCCAAACGGCGCCTGGACGGCCGAGATGAGGCCGACGTT
GATGCCGACCATGCCCGCCTCGAGGTTCTCCGACATGCGCCACGCGCGTCCGAGGTCCTTTGTGAAGCAATAGGCGGCGAGACCCATTTCAGTGGCGTTG
GCCACCTTGACGACTTCGTCTTCGGTCGAAAACTTCTGAAGCGCGACGATCGGGCCAAAGCACTCTTCGTTGGCGACGCGCATGGCCGGCGTCACGTTGG
TGAGCACGGTCGGTGTCATGTACGCCGGGCCGAGCGGACTCGGGGTCGCGCCAAGCAGCGCCGTCGCACCGTGCGCAACCGCATCCTCAACCACCGCCGT
CAACTACAATGCACACCCATGTCAGATCTCAGATCTGAGAGACCACAAGATGGCGAAGAAGCGGACCTTGGTCACGGCACCCGCGTTGATGAGCGGACCA
AGGTCAAAGCCGCGCTCGTGTGCAATGCCTTGCTTGAGCTGCGCGACGCGCGCCACAAGCGCGGCCGCAAACGCGTCAAAGCTGCCTTCCTGCACGTACA
CGCGGTTGGGGCACACGCACGTCTGGCCCGTGTTGCGAAACTTGGCCTGGACGAGGCCCTCGACAGCTTCGGGGATATCGGCGTCGTCAAACACGATGAA
CGGCGCAAGTCCGCCAAGCTCCATCGACACCTTCTTCAACGTGCTCGCACACTGCTCTGTGAGGAGCTTGCCGACAACCGTCGAGCCCGTAAATGTGAGC
TTGCGCACCTAGCATAGTAGGATAAGACTTGGGTTCGAAAGAGGCAACTTGACATACTTGCGTCGCCGTCGAGAGGGTACGGCCAATCTCGGCCGCGGCC
TCGCGCGGGCTCGGCACAATGTTCATGACACCAGCGGGCACGCCAGCCTCCTCGCCGAGCTTGGCGAACGCGAGCGCCGAGAGCGGCGTCGACTCGGCGG
GCTTGACGACGGCCGTGCAGCCGGCCGCAAGCGCAGGTCCGACCTTGCGCGCGAGCATGCCAATGGGGAAGTTCCAAGGCGTGATCATGGCGCAGACACC
GACAGGCTGGCGCATGGCCATCATGCGACGGCCCGCGGCGTGGCTCGGGATCATAAAGCCTTCGTAGCGCAGCGCTTCGTGCCCGAAAAACTTGAGGTAG
TCGGCCGCATACGACACTTCGCCAATGGCCTCGGCAATCGGCTTGCCGCTCTCCTTGGCCATGATCATGCCAAGGTCCAGCTCGTTTTCGCGCAGGAGGC
GGTCCCATTTCTGGAGAATCGCCGCGCGGTGCGTCGGCGTCGTTTTCTTCCACTCGTGGAACGCCACGTCGGCCGCATCAATGGCTGCCTTGGTGTCGGC
CGCGTCCATGGCCGCCACGTCGCCCAAGGGTGCGTCCAAGGACGGATCAATGACCGTGTACGTGGCACCTACAAACACGCTGGTCAGTGGCACAGGGTGT
TGCATGGAAGCGCACCCGAGATGGCATTGAGCCAGCGGCCACCAATGTAGCCTTGGGACTGGATCAAGTCGGGGCGGCGCAGAAGGCCCTTGAAGGCGGA
GGTGAGTGTCATCGGCAAAGGCAAAGGCAAAGTGGCGAC