Description :
From Genome Similarity Track
Location :
Scaffold_106:17326- 19037
Sequence
1711 bases(100 bases per row)
GACTTAGTCTTAGTCGTCGTCAGCGTCGTCGACCGGGGAAGTCGGACTTCGAGCCGACGCAGAAGAGAGGGGAACGTTCGAAGGGAGATCCGCCTGCGGG
TAAGCCTGAAGGCGCCCGACATAGAACGTCGGGTGCAAACGTATAGTGGTAGGTATGGCGAGCGTGCAAGCATCCCCATGTGCCTTAACAACCCTAAATG
GACCAATATATCCTGGTGCTAATTTATTAGAGCCCAAGTTCGTCATAGATGTGTCTAGTAATCCACTTGTCGATTATAAGACTCTGTCACCTTTTTTGAA
CGTCAACGTGTTCTTTAGACCTGTCTTGCCAGCGTTCTCCTTTTGTTTATCCACAGCTCCTTTGAAGGGCTTCACGTACAAAACGCATGATACCCTGTCG
TAGTAATCGGAATTCGGTCAAAGCAGCCGAACTTACAGGTGAAGCGGACTCTTTCGAAACAAAATTAGCGGCGGAAGACGCGATAGGATGCATCGCGTCG
GGACTCAATATGCCATTGGCCGCAAAATTAACAGCATAAGTTGCATCGACAGCAACCTTTTCTTCAACGTAAACAATCATCAAGTTTCTCGGCGTAATGA
AATCGGCAGATACTCCCCCACAAAGCTTAGAAACCGGGTGTTCTGAGGCTGAAATAGCAATAAGCGCTGGAAAGCGAGGGTGCCTTGCGTTGTTCACGAA
AAATGGCGTCAACCCTGTTGACACATGAACTGCATTGCTGATTGGAAATTCAGCGAGTGGGAGAAATGGACTTCACGACGTAAATGGTGTCGCATAACTG
CGCAGGACGTCTTCACGCGCTCTGTTCACGCGCTCCGGTTTGCCCGTACGTCTCTGGATGGGCTGCCGTAGACATAAGCAATCGCGTGCTTATTAGTTAA
AACAACTCTGCCCTAAAAGCCGACGTGAAACGCGGGTCAAGGTCCGAAACAATGGATTCTGGCAAGCCGTGGTGCCTGAATATAAGATCGAGAAAAATCT
TCGCGGTCGTCTTCGCTGTTACGTGCGCGGAGGCTGGAACGAAATGCACCATTTTGCTAAATCGATTTACAAGAACCAGTACACCCGTGCGTTCCTGTTC
ATCCGGTGGAAGATCAAAGATTAAATTCATGCTGACCGAACGCCAGGCTTCCGTTGCAATCGGAAGCGGTCACATTGGGGCTTGTGAACAAGGCACAGGC
ATCATACGCTGGCATGTTTCACAGGAGCGTACCCATTTCTGGATGTACTTGTACATACGCGGCCAAAACAATACACGAGAAATGTCCGCGAACGTCTTTT
CGCGACCCAGATGACTACCAGCTGGAGTGTCATGAAATTCGTGCACAAATCGTGCACGGAGGTCGTCATCAGCAGGGATGACGACGATTGGTGGTTCAAA
GACGTCCATCGTATACTTCAGCAGCGGACCATCAAGCGCATAACGCTTGATGTTGTCGCGCGTTGGTTTTGTCAACTTCGCGAGTAACCCCGACTAGGGT
GTTGAAGGTAATTGATGATTTCTGTTTAGAAAGAATCATTCGCATATGACTCAGCGATCTGACTCCGAATTTACAGCACATTTGTCAAAATCATTGCATT
GAGCCCCAGCTCAGCACGGCATAAACAAATGTCATCGTCTTCATCATCATCACTGCCTGGCTGATGACGCATGTCACGACGAAGATCACAATTGAGATAT
CGAGAAAGCGC