Description :
From Genome Similarity Track
Location :
contig_40:173256- 174306
Transcript NameFunction/comments
g7350.t1hypothetical protein

Sequence
1050 bases(100 bases per row)
CCGGTTGAAGCACGTGTGCGCCCGCGGATACAAGCATTCGTCTGCGCTGACGCACTGGATCGCGAACGGGCAGATGCGTCCGTCATTCATGGTCAGCGCT
TTGAAGCCTTGTACTGGCACCCGCGCCGAGCCGGTTGTGAACTGCAGCAAGCGCGCCTTTTGCTCGTTCGTGAATTCATGGACGATATTCCAGAACCAGG
CGATAGCTCGCTCGTCGCGCTCCCCCACATAAATAGTGTGAGTCTTCCAGTCCTGCACGTCAATGTCGGGGATTCCACAAATCAAGAGCTCCAACTCCTG
GTGGTCGAAGACAGAGATAAGCTCCTTGGGAATAATTGAGAAGAGGCCCTGCATCAAGGATCCCAGCTGCTGCGATATGCTGTTTGCAACGATCCACTTG
AAGCGCAGGTTGACGTACTCCATCTTGTTCTCTTCAGTGACGGGGATGTTCGATCCGTTTGGTACCAAATCCACCACCTTCGCCTTGTCAGACATTTGGT
CGACGTTGACACTGGAAATGCACAAGACAATTTGTTAACATGACTGCAACTCAGTGGCTTGAAACAGAATACTACGTACGTGAAGTCCAGGGCCAATGAT
TCTACACCCGTGTTGTCTCGCAACCACTTCAAATTCTTGTACAGGTCGTTGTCCACGAACTCCAAGTCCGAAAACGTAATGGGGATACCCAGAATATGCT
TGCATACCGGGAGTGCCAAGTGTGCATCGATGAGGATACCTTCGAAGAGCGCTCTACCGATGAAACGACCAATTGCTTGGTAGTACTGCACACACACACA
AACAACTGTAAGAACACACCAACACATCGACAACTACCGCAAAGCGTACCATCAGGTGGTCAACACTGGCTTCAGCGGACGCAGGATTCACCATGAGTCC
ATCTCCGTTACCGCTTCTGTAGAACAGCCCAGTAGCATCATCGAAGACCTCCTTTGTCATCAGCGTAAACCATTCGCGGACCAGACCACCTGCATCCACG
CCCGGCTCGTTCGCGAACTTGATTCGAAGAGACTGGTGCAGCTGATCCGG