Description :
From Genome Similarity Track
Location :
Scaffold_65:173207- 177091
Transcript NameFunction/comments
Phyca_LT153482052adenylate/guanylate cyclase
Phyca_LT15341269353'5'-cyclic nucleotide phosphodiesterase, putative
Phyca_LT153420507fatfree family protein putative

Sequence
3884 bases(100 bases per row)
gaggtgaagctggtgcgggtgcctgtacgggagctcaaggtggctatggatggggtaagggcggcattagacgagaatcggagactggcggtggaacttg
gacaggtggaggaggaggtgagggagctggagcttaatctgctcaagcgacaacaccagctggacgtctgcactggtacccgggcagatcatcgtccgta
tcgtccgggcgaattgtctaggcccacgcagccgaaacggccgcgacctaagagcgaaatgttcagcagtgctggcagcatgcgcaacctcatcggagag
caagctgagacgttgaatcaactcacggagagagaagaaaacgtaagtttcggtgaagctctcgatagatttcgctgttgacgtccatgttgtatgtcgt
cagcttcgagcactcatggacgctatgcgggagatctcgcaagcctccgacagtctggacatcgtgagcaacgcgcttcgtgcagcacaacacgttctac
cagcagagaagtacacgatcgggattctacacgacaaaaaggaccgtgtagagctgtactccaacccgccgataaacttgcctggaaaacgataccttat
ggaggaaggcagcgtcctggttgactcggccacaacgtttggacgcgttgtgctggtaggcgatcactgctttctgatgacttcggtaccagtttaacga
tgttcatgtacgcagactggaacacctctcgaagtcgcggacgtcagcggatcggaggtcatcgacgttttcgaagagcagatggaattgctggagttcg
agcctgaggctttgctctgcgcacccattttcaacgtccacggggtattagtcggtgtcttccaggtcatcactcgtaagatcctggatctgtcatcgcc
agcaccctctccagagcctctaaggttctcaacaacccctcgcgctgcagtagcgagacgtggacgcagtcaggactcgaaacaacgacgagcgtttgat
gcccgcgacaaggaaagcttcgactacatctgcgtgactgcggggacggcgttatggaacttgtcgctggctaaagctcaccaggccatgcagagccgaa
ttgagtgccttcttaaactcaaccgaaacatcgcagcggaagtcagtgcgtccgccgtgctccaccagatcatcgccgtgtcctacgagctgctgcgcgc
cgaacacattgcactgtatgttcgtgatgaaggcacagatgagttctaccttttcgtcagcgagtacaaggatgagggtgtgactccagtgaccacacca
accaaaggcaggaacaaacccaggggcaagactagtgaaaggtctcaacattcccaggaacaggtacagcatgcagaatacgacgaggcgttcttgaaag
cgcacaacggcattgtcggcgtcgtcatacggacaggacaactcgtcctcaccaattcagctccaagtcacgtcgcattcgacccaaagtttgacgaaat
gtggacatcccttaagacgaaacaggtactctgtgcgccggttaaagacgctggtgggcagattctagctgtcgtgtgcgccaccaacaaagtcgacggc
gacgagttcacagcagacgacgcgctgtacctgaactacgccgcagaagcagcagggatttcgctacacaagtccaacctgctgcgctccgtgctgatgt
cgcagaggttgaccgaagcgcgtctgcaactcgctggcttcgtaaacagcaacggagaacgcgcgtacagttccaatcacggacccgacgacgaaacgag
tgccaccgcttcagttgcgaggtttgtgcgtgtcgtaatggctgagggtcgaaagctgcttcattgcgaccgatttggcttcttactggtggacccactg
aagaaagagctctggatcacccaagaagacggccaaagcgttcgaatgccgctcaccaacggcctctcggggttaatcgcaacgacgggaaagacgatct
gcacgcgtgacgcttacactcattctcactttgatcccaccctggatcgcaagaccggataccgcaccacaaccgtgcttggaatgccagtgtttgaaga
tcacacgccaattaaccccaagattgtagcggtagtgatggccatcaacaaaaaagacgataatgattcgggaaccgataagggacacgatgggcgtcgc
gttctcagacactgcgtgccattcactgtgaacgatgccgagtgcatggcgcagtattgtcgagagatccaattcgcacttggtcgactgtcgctggata
tttcgtactacaaagtggtatcggactgcgcgctcggtacaccaggtgaagctttggtcgactcgattgatgcttcgaaaacgcaggaacagcaagtgag
cgacgtgaacgagcctgaaatcatctcgtccatagtgcagaagttctgccaatcgagtgaactggacgctctggaagaagtggcagccgcggccatggct
gacgaccctgacgatgtcgaagaattcgacgatgcaaatgaaaatgacgatggtaacagtgactccgacgaagaagaacgcgtaactactccgttttctg
ccaccccgtttccccctcggagtcctcagcgacgcatctccacaactcgtgagaacggacacgtgataggcgttggagacgtgacgcgttgggacttcag
cactctagatctgtccagtgccgacatctacgcggcgacatcggtactcttccgctcgctcggattgctggagcgtttccaggtcgcacaggagacgttc
tccactttcctttcgcatgtggcgtcccattatcgtcaaaatgccttccacaaccttcaacacgctttccaagtcactcacgcaacgtattgtctgctac
gtcggtcaggtgtcgcgcactcgtactttgcacgagtggaaatctttgccatgctcgtagctgcactgtgccacgacctagatcaccctgggaacacgaa
cgacttcgaggtgaaggcccatagccagctcgcactcacacacaacgacgatgctgttctcgaacgccatcattgccgcgttgctttcattatcttgagt
catccaggagcaaaccttctcgctcgactacccacacgtgcctgcttcatatacatgcgtcgactgctcatccactgcatcttggccaccgacatggcca
aacactttgagaagtgcaaggcactcgaaggtctctcgaagcgccatcttgttgtcaacaataacgggggcagaggaacaagacgaagccggagcaaaca
tcgctttgtcttcatggccatcatcatccacgctgccgacttgtctggccaggcactgccgtacacacaggcagttcgatggggtatgcgtgtactctcc
gagttccagcagcaagcgaagaacgaagccgaacttcattttcccgttgattccttcatgacgaatctgcaccacgccaaaacgcgagtcaccgttcagc
tcaacttcattaactacgtactgcgtccaatttggctgccattggccactctgtgtcctgctgtacgggtgtacgccgactcgctggagtccaatcggga
gcgttacaaggcagagctggacaaacttcagcgtgaggcggagatcgacgatctggcgagagtttacgtgcgtgagtccagctctcgaacccttgtgggg
cgccctgccgatcaccaaagctgattgttagtacaaaattccactgtaaccaggcaagatattggtgaatgagcatattgacacaaccctgctacaatca
gcctcggcgtgacagaacttgagtgctcttggtgcttacgatagcgacgacattgctttggtccatcaggatatcttcaaccga